SimpleSearch - Line and FST details


Line specific information

 
Line ID 012B07
Vector Used pAC106
Line Availability only available from NASC (N401075)
Segregation Analysis 15:12:8
Confirmed for Hit At3g16340
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g16340

 
Sequence (A. th genome BLAST matches underlined)
>50-K012438-022-012-B07-8409
NTGAACCATGTAGACTTTCCCGGACATGAAGCACTTTACAATTGAATATCTTCTGTCACT
CATCTTGCACAGGAAACAGATGGTTGAACCTAAGGGATCCTTCCTATAGTGAATCGATGG
ACGGCAATTGACTTTTTCAGAATCGATGGGAATCGCCAAACACTGTTTCCTTTTCTCAGT
AGTTGACCATCATACGCAAATGCTGATCACTGATCATCCGCCATAGCGAACGAAAGCATG
ACCACTGACCGGAAGTCACTGAAAAAGAGTTGGTTATCCAGGGTGGGCTACTTGATCCTC
CCTATAAAGAGACTAAATATGAAAAAATGGTAACACTTCTTCTTGTAACTTAACACCATT
TATAATAGGATCTCAATCCATACACCAACTTTTGCAGAGATTTGTGGATGAAGTGATGGA
GCTATGGGATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession AL752355 [GenBank]
Graphic View Graphic view of gene At3g16340
Predicted Position of Insertion Chr3:5544045 - go to primer design
BLAST e Value 7e-55
Hit Clone Code (BAC ID) T2O4
Hit Gene Code At3g16340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation pleiotropic drug resistance 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03