SimpleSearch - Line and FST details


Line specific information

 
Line ID 013E08
Vector Used pAC106
Line Availability only available from NASC (N401208)
Segregation Analysis 50:48:46
Confirmed for Hit At2g46505
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g46510

 
Sequence (A. th genome BLAST matches underlined)
>61-K024345-022-013-E08t-8409
TCATCCACAGTGAACTATATCCTGNAACATTCCATTGGTGTGACTACGGGATAGGCAAAT
ATTTTCGCTGCATACAAATATCGTCAATCAATGTGTCTAAATAAAGTTAATGAATATACT
TAAACCGGATTCCTTTCACTATAAGAAAGAGAAAAGAAAAAAGGATTTTATCTATTTCTA
TGGGATCCTCCCTATAGTGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATGAAAATANGGTGGAANAAAAAG
ANAAATTANAATGGGGAGTATTTATAGGGGAAAGTAATAAANAAATTATTTTAATTAGGA
AATATTTATTTGAAAGTGTTTAAATTAAAGTGAGAATGGGGGATAAAGATTGAGAGGATA
GTAGTAAAGAATGGAGAAAAAAAATAAGAATTAGTAATGAATAAATGGGAGGGGAAATGA
GAGAGAAGAAGAAAGAGATTAATTATAAGTTAATATAAATTATAAAAT
GenBank Accession BX890690 [GenBank]
Graphic View Graphic view of gene At2g46510
Predicted Position of Insertion Chr2:19090975 - go to primer design
BLAST e Value 4e-43
Hit Clone Code (BAC ID) F11C10
Hit Gene Code At2g46510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ABA-inducible BHLH-type transcription factor
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CT025969 [GenBank] CT025969 [GenBank] BX890690 [GenBank]


Last Updated on 31.08.2016 09:40