SimpleSearch - Line and FST details


Line specific information

 
Line ID 013E08
Vector Used pAC106
Line Availability only available from NASC (N401208)
Segregation Analysis 50:48:46
Confirmed for Hit F11C10
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F11C10

 
Sequence (A. th genome BLAST matches underlined)
>61-K025676-022-013-E08C-3144
TAGGGATGACATCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTT
CATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTT
TAAACTATCAGTGTTTCCCATATATGGTTGCTGATCATATTGACCATCATACTCATTGCT
GATATCTCCATTTACAAGTGGATCCATGTGGATTTCCCGGACATATTTGTAAGCAAGTGG
ATTTATTCAGTTACAATTTGGGATCCATTCTTTTTTTTTTTCAAATAAAGCAATAGTTAT
AACAAGTTAATATTATCCAATCAATGTTATTCAGGAAAATATTTGATTAATTATCTTGAA
AAAGGTTCATGTACATTTGAATTTTGAAGTGACCAAATCTTATATATGGGTCATGAATAT
GATATATTGACATTTCAAGAGACTGAGCTAAAAATTACTTAAAAATGAGAATCAATTATT
TTTTTTCCATTGGCCCATTATTTTATGCAATGCAGCACATAAAAATCTATTTTGGTTTTG
GTTTGGGCTTCTGGTAGTTCTGAAAAGCCCAGTATAAAGCCCAACTCCATTAATGCATCT
TCACCTCT
GenBank Accession HG968565 [GenBank]
Graphic View Graphic view of sequence HG968565 of line 013E08
Predicted Position of Insertion Chr2:19090934 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F11C10
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03