SimpleSearch - Line and FST details


Line specific information

 
Line ID 015C10
Vector Used pAC106
Line Availability only available from NASC (N401378)
Segregation Analysis 50:50:41
Confirmed for Hit At5g20990
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g20990

 
Sequence (A. th genome BLAST matches underlined)
>75-K013040-022-015-C10-35St
NAATAGACGTAAGGGACGACGCTTCATCCCCTATCCTTCGCAGACCCTTCCTCTATATAA
GGAAGTGCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCC
TTCGGTTTAAACTATCAGTGGTTGATAGTCAACTCTACATTATTAATATTTGCATCCATT
TTGCCACATTATAACAAAATCGAGAAGGTGAATCTATGGGATCCTCCCTATAGTGAGTCG
TATTACTCACCTTCCCCCCATCTCTGTGAGCGACGGGGCTACGGAGCGATCCACATGGGA
CTTTCAAACATCATCCGTCCGATGGCCGTTGCGAGAGAACCACTCCATCACTGAGATCAC
CCGACGCCCCGCCCATGCTCGCACCCCCAATCGATACGATTTTGAACGCTTGCCCAACCC
AGCCCCACGCTCCCGCCACCCGGGCCCCCCCCTCCCGGTCGATCTCCCCCCTTCCGTCGC
CCACCAGTCACTCCGCCTTTTTACCTTCACACCCACCCATCCTTTTTGCCCCCCAACATG
CCACGCCTACCGCCTCCAACTTCTCCCCACTCGCCTTCTCAGTCCTGCCCATATTCCATG
CGTGCTTCTTCTACTTCAGGGCCCCCTACCCCCACTCACATACACTCTTCCTTCTTCAAC
ATCGCCCACACCTTACCTATTCCGTTATTCACTCTCACCCCCTAAATCACCCTCACCACT
TCTTTTCCTTCTTCCATCTCATCTCCTTTAGACGTCCTCTCTCCATCTCTACAACTCCAT
TTCCCCCTTTGTCCATTTTACATCCCCCTTTTCCGTCACACAATCGTCTGGTGTCCCCGA
TAAGACTCCCCCCCCCTCTTATTCATGCGGTCTCCTATTTTATCCCCCCGCCATCATATA
TTTGTTTTTCC
GenBank Accession AL752584 [GenBank]
Graphic View Graphic view of gene At5g20990
Predicted Position of Insertion Chr5:7130100 - go to primer design
BLAST e Value 6e-28
Hit Clone Code (BAC ID) F22D1
Hit Gene Code At5g20990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation molybdopterin biosynthesis CNX1 protein / molybdenum cofactor biosynthesis enzyme CNX1 (CNX1)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL752584 [GenBank]

Gene hit MPO12

 
Sequence (A. th genome BLAST matches underlined)
>75-K019122-022-015-C10-8409
AATTCAGTGAGTGATAACTCTGTGACCAGAAACTTCTTACAAGACTTACTTCATTTTGGT
CGATTAAAAAGAGTGCACCTATGGGAGTCTCCCTATAGTGAGTACGTTCGCCCATTTGTA
TGTGCATGCCAACCACAGGGTTCCCCTCGGGAGTGCTTGGCATTCCGAGCGATAATGACT
TCTGTTCAACCACCCAAACGTCGGAAAGCCTGACGACGGAGCAGCATTCCAAAAAGATCC
CTTGGCTCGTCTGGGTCGACTATGGGATCCTCCNTATAGTGAGNAAATACTTTTAATTAA
CTATCCATGTTGATCACAAAGAGATTTCTTTATAAAAAAACTTTTGGCACTTATATTTTT
TAAACACCACTCCATATATATAGTTGGTAACTTATCCTTAAATTACTATATCTTAAGGAG
ATCAACAAGTTGAATCTTTCTCGAAGTGATTTAAAGAAAATAAGAAGATAAGTGAAACTG
ATGATGCACTA
GenBank Accession BX284964 [GenBank]
Graphic View Graphic view of sequence BX284964 of line 015C10
Predicted Position of Insertion Chr5:16124676 - go to primer design
BLAST e Value 4e-69
Hit Clone Code (BAC ID) MPO12
Insertion Classification Genome Hit
Confirmation Status unknown
Other FSTs Supporting this Hit BX284964 [GenBank]


Last Updated on 31.08.2016 09:40