SimpleSearch - Line and FST details


Line specific information

 
Line ID 015C10
Vector Used pAC106
Line Availability only available from NASC (N401378)
Segregation Analysis 50:50:41
Confirmed for Hit At5g20990
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g20990

 
Sequence (A. th genome BLAST matches underlined)
>75-K013041-022-015-C10-35St
NAATGGACGTAAGGGATGACGCTCAATCCACTATCCTTCGCAGACCCTTCCTCTATATAA
GGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCC
TTCGGTTTAAACTATCAGTGTTTGATATCAACTCTACATTATTAATATTTGCATCCATTT
TGCCACATTATAAGAAAATCGAGAAGGTGAATCTATGGGATCCTCCCTATAGTGAGTCGT
ATTACTCACCNTNCCNCCANCACGGCGAGCGACGGGGCAACGGAGCGATCCACATGGGAC
TTTTAAACATCATCCGTCGGATGGCGTTGCGAGAGAACCATTCGATCCGTGACATCAGTC
GACTCACCGGGCAGGCGCGCAACACGACCGCTTACTATTTGAACGCATGTACAATCAAGC
CGCACGCTCCGGTCCCGGGCCCTCCCCTCGCAGTCTATCCAACCCCTCCGTTGCTATAGT
GCA
GenBank Accession AL752585 [GenBank]
Graphic View Graphic view of gene At5g20990
Predicted Position of Insertion Chr5:7130096 - go to primer design
BLAST e Value 9e-33
Hit Clone Code (BAC ID) F22D1
Hit Gene Code At5g20990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation molybdopterin biosynthesis CNX1 protein / molybdenum cofactor biosynthesis enzyme CNX1 (CNX1)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit MPO12

 
Sequence (A. th genome BLAST matches underlined)
>75-K019208-022-015-C10-8409
CCGTTCGTCCATTTGTATGTGCATGCCAACCACAGGGTTCCCCTCGGGAGTGCTTGGCAT
TCCGTGCGATAATGACTTCTGTTCAACCACCCAAACGTCGGAAAGCCTGACGACGGAGCA
GCATTCCAAAAAGATCCCTTGGCTCGTCTGGGTCGGCTATGGGATCTCCCCTAATAGTGA
GAAAANACTTTTAATTAACTATCCATGTTGATCACAAAGAGATTTCTTTATAAAAAAACT
TTTGGCACTTATATGACACAAAAATCACTTCATATATATAGTTGGTAACTTATCCTTAAA
TTACTATATCTTAAGGAGATCAACTGTTGAATCTTTCTCTAAGTGATTTAAAGAAAATAA
GAAGATAAGTGAAACTGATGATGTGCTATGGG
GenBank Accession BX284965 [GenBank]
Graphic View Graphic view of sequence BX284965 of line 015C10
Predicted Position of Insertion Chr5:16124668 - go to primer design
BLAST e Value 5e-99
Hit Clone Code (BAC ID) MPO12
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03