SimpleSearch - Line and FST details


Line specific information

 
Line ID 015G11
Vector Used pAC106
Line Availability only available from NASC (N401427)
Segregation Analysis 50:48:36
Confirmed for Hit At5g14640
Parent of DUPLO pair none
Parent of pair(s) 5015, 5030, 5059, 8596, 8597, 8610, 84630, 84641, 84647

Gene hit At5g14640

 
Sequence (A. th genome BLAST matches underlined)
>87-K019122-022-015-G11-8409
TATCATGAAATTTCCCGGACTGAAGCCTTTACATTGAATATATCCCTTCTGTTCTGGTGT
TAGTTTTCATATTAACTATATTATTTGTTTTATAGTCGTCGAGTCCTAACTATTTTAGCT
TTGCCCCTCTGTAACAGGTTAAAGGCGAGCCAAACATCTCATACATCTGCTCCCGTTACT
ATCGAGCACCTGAACTTATATTTGGAGCTACAGAATATACAACAACAATTGACATATGGT
CTGCAGGCTGTGTTCTTGCTGAATTGCTTCTGGGACAGGTAATATGACTGTCCAAACTTT
CCTCCATTTATCTTTTACAAATGATTTGATTTACCGAATGATGTCTAAAGTTATATATTA
CCTATCTTTGGCTTGTCCAACTTTTGGTTAGCCTCTATTTCCAGGTGAGAGTGGAGTTGA
CCAGCTAGTTGAGATAATAAAGGTACTTCAATTTGGTTAAACAAACACACATAATCCTAT
GG
GenBank Accession BX285014 [GenBank]
Graphic View Graphic view of gene At5g14640
Predicted Position of Insertion Chr5:4720494 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T15N1
Hit Gene Code At5g14640 [TAIR] [MIPS] [SIGnAL]
Gene Annotation shaggy-like kinase 13
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23