SimpleSearch - Line and FST details


Line specific information

 
Line ID 016D02
Vector Used pAC106
Line Availability only available from NASC (N401478)
Segregation Analysis 100:96:92
Confirmed for Hit At1g64280 At1g18130
Parent of DUPLO pair 2546
Parent of pair(s) none
Note Although the line exists, the insertion in F13M14 can not be ordered because the confirmation of this insertion failed.

Gene hit F13M14

 
Sequence (A. th genome BLAST matches underlined)
>12-K012439-022-016-D02-8409
TTGTACATGTAGATTTCCCGGACTGAAGCACTGACATGTGGATTTCCCTGGGTATCGAAG
GCGCGCGTGACCGACTGTGGGAGGCTCTGCTGCGAATACGCCGTATGACCCTGCGGACAC
TAACATTTTTGAATTGAAAAAAAATTGGAATCACTCTTTTTTTTTGCCCTATTGACCATC
ATACTCATTGTTGGACCTGGCTAGGCTAAGGACACGAGAGCCCTCTTGTCAAAATCGTGA
GCGCTCTAGGAGACTTGGGACCTAATTCGAATGAGGACACGGGCACCGCGCCTATAGTGA
CGGACAATTCTCAATTGAGTTTATACTTTGCTATACGTTGTTGATGTTCTTTTTGTCTTC
ATTCTTAGAATTATCAGCACTCTTAACATGTACACAAACTCGCTAAGCTATGGGATCCTC
CCTATAGGGAGTCGTATTACTC
GenBank Accession AL752638 [GenBank]
Graphic View Graphic view of sequence AL752638 of line 016D02
Predicted Position of Insertion Chr3:3282947 - go to primer design
BLAST e Value 2e-43
Hit Clone Code (BAC ID) F13M14
Insertion Classification Genome Hit
Confirmation Status failed

Gene hit At1g64280

 
Sequence (A. th genome BLAST matches underlined)
>10-K020161-022-016-D02t-8409
GAACTCTTCAAATACCAAAGACGTATGGGTATCCTCCCTATAGTGAGAAGANNNNNNTCC
NAGGGGATATACGGGGCTTCATGTTGCTGCGATGCGGAAGGAGCCACAATTGATACTATC
TCTATTGGAAAAAGGTGCAAGTGCATCAGAAGCAACTTTGGAAGGTAGAACCGCACTCAT
GATCGCAAAACAAGCCACTATGGCGGTTGAATGTAATAATATCCCGGAGCAATGCAAGCA
TTCTCTCAAAGGCCGACTATGTGTAGAAATACTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX530742 [GenBank]
Graphic View Graphic view of gene At1g64280
Predicted Position of Insertion Chr1:23854409 - go to primer design
BLAST e Value 1e-115
Hit Clone Code (BAC ID) F15H21
Hit Gene Code At1g64280 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation regulatory protein (NPR1)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g23630

 
Sequence (A. th genome BLAST matches underlined)
>07-K028183-022-016-D02t-8409
TAGAGAGCGGAACTTCAAAGAGAAGTCATATAACAAACAAAGATGATGTTAATGAAAAAA
AAGTATGGGATCCTCCCTATAGTGAGTCGTATTACTCACGCCCTTATACTGCTATTGTTT
TATGATACCTTTGCATTACATGATGTCTATAATAGGTTCCAATTGTTGGCCAAAGATCTG
ATGAAAAATTATCGATCAAAAGAAATAAGAATCATGTTTTATTTGGCGGGACCAAGATCT
TGCAACATTCACCTGACAAGGTATTTCCGTCTCAGCGATATCANCCATTTCCTTCTTCTG
TATGGGATCCTCCCTATAGTGAGTCGNNNGNNNNNNNNNNNNGNNGNNGGGGGGGGTCTC
ACTATAGGGAGGATCCCN
GenBank Accession CR769880 [GenBank]
Graphic View Graphic view of gene At5g23630
Predicted Position of Insertion Chr5:7965741 - go to primer design
BLAST e Value 5e-86
Hit Clone Code (BAC ID) MQM1
Hit Gene Code At5g23630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phosphate deficiency response 2
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At1g18130

 
Sequence (A. th genome BLAST matches underlined)
>11-K017011-022-016-D02T-8409
TGTCATGACATTTCCCGGACATGAGCCATTTACAATTGATATATCCTTGACATGCATGCC
GAGACTATGGGATCCTCCCATATAGTGAGAACCATTGAGGTTTATGTTCCCGTATACATT
TTGAATGATGATTGTGGTTGTGAGTAGGTGCAAGAAGCTCAGGTTGCACACTACAACTAC
ATACTAGCCGTGGGTGATGAAGAGGCTATGGGATCCTCCCCTATAGTGAG
GenBank Accession AL936019 [GenBank]
Graphic View Graphic view of gene At1g18130
Predicted Position of Insertion Chr1:6238478 - go to primer design
BLAST e Value 2e-58
Hit Clone Code (BAC ID) T10F20
Hit Gene Code At1g18130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Class II aaRS and biotin synthetases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03