SimpleSearch - Line and FST details


Line specific information

 
Line ID 016F01
Vector Used pAC106
Line Availability only available from NASC (N401501)
Segregation Analysis 100:98:97
Confirmed for Hit At5g65687
Parent of DUPLO pair none
Parent of pair(s) 95162, 95163

Gene hit At5g65687

 
Sequence (A. th genome BLAST matches underlined)
>18-K020160-022-016-F01t-8409
AGCCATTTACAATCGAATATATCCGGATCCGGGGAACATTTACAAGGATATTTCAAGTGG
GATCCTCCCTAATGGGAAGAACTCCGATATTTACCGGGGCCTGAACAGGATTATCCGATG
ACACCCTTAGTATGCGCATGCCAACCACAGGGTCCCACACTAGATTGCTGGGCAATTACT
TGCGATAATGATCATGTGACCTGCCGACCGCAACGATTAGAAATTCTCCCGATGGAACAA
CATTCCATAAAGGATTCCATATTTCTTCTGGGTAAGGTATGGAATCCTCCCTATGCGCCG
AGTAAAGTTGATGCAGCTATGGGATCCTCCCTATAGTGAGACCCCCCGATTTTCCCTCTA
TATTAACACACTGAAT
GenBank Accession BX530743 [GenBank]
Graphic View Graphic view of gene At5g65687
Predicted Position of Insertion Chr5:26270445 - go to primer design
BLAST e Value 1e-05
Hit Clone Code (BAC ID) MPA24
Hit Gene Code At5g65687 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Major facilitator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40