SimpleSearch - Line and FST details


Line specific information

 
Line ID 016H02
Vector Used pAC106
Line Availability only available from NASC (N401526)
Segregation Analysis 50:45:42
Confirmed for Hit At3g62680
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g33900

 
Sequence (A. th genome BLAST matches underlined)
>16-K013042-022-016-H02-35St
NAATTCGCGTAAGGGATCGACGCATAATCCCACTATCCTTCGCAGACCCTTCCTCTATAT
AAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCG
CCGGGGACAGGGTACGTGTGTTTCCATCTGCTTGTACCCTCGATGGGAGAATATATGTTA
CGGGAGCCTGCGAAAATCTCAATTCAATGAATTGGATGGAGATTTTTGATACGAAGACTC
AAACTTGGGAGTTTTTACAGATCCCTATGGGATCCTCCCTATAGTGAGTCGANTTACTCA
ANNNNCNNCNNNCNCCCCCCCCCNCCCCCCCCNCCCCNCCCCATCCATACACCATCGTTC
CTCACGATTCCATCCCTTCTTCTGTCCATCCTCGCAAAAACCACCAAAACACAAAAAAGG
GTGTTTTGTTTTTTCGTACCCATCTCTCCCCCCCCCCCCTCACCCAACCGGTCTCCCCCC
TTCCCCCCATGCATTTGCTGGTTTCTCTTCATCCCCCCCCCAATACCCCCTTATCGTCGT
TTTACAAACCAATGTGACCCACCCACTCTCCCCCTCGCCGCCCCCCCTTATCCCCTTTTT
ACCCCCTTCCTTACGCCATAAAGTCCCCCCACCGCACATCTCCCCGCCCACCTGCAACAT
TACATAACCTCACATTTCCCTCACCGCCCGCCCCAATAGATGGCTAAATTCGACTGTCCC
CTCAAACCACTGTACTATTCACCACGCTACATTCACCAAAAGATCCATCCCACACACTTT
CCCCACAAGATGCTGATACACTACGCCATATTTCACTTCCCCACATCCTCTGTTTTCCGC
TCCCCCCCCGCCCGATTATTTCCGCGTCTATTACGACCCCCTTCTCACCTCATTCTCCTT
TCTCTCTTC
GenBank Accession AL752684 [GenBank]
Graphic View Graphic view of gene At4g33900
Predicted Position of Insertion Chr4:16252219 - go to primer design
BLAST e Value 8e-67
Hit Clone Code (BAC ID) F17I5
Hit Gene Code At4g33900 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Galactose oxidase/kelch repeat superfamily protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At3g62680

 
Sequence (A. th genome BLAST matches underlined)
>20-K017012-022-016-H02T-8409
GATCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATTCAAATTTTTAATAC
CCCAAACATTTTCTTATAAAGCCCCATTTGGTGAAATCGTTTTCCTCATCACAATTTAAA
TACAAAGAACACAACAAACGAACTATGGGATCCTCCCCTATAGTGA
GenBank Accession AL936039 [GenBank]
Graphic View Graphic view of gene At3g62680
Predicted Position of Insertion Chr3:23182641 - go to primer design
BLAST e Value 7e-52
Hit Clone Code (BAC ID) F26K9
Hit Gene Code At3g62680 [TAIR] [MIPS] [SIGnAL]
Gene Annotation proline-rich protein 3
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g10850

 
Sequence (A. th genome BLAST matches underlined)
>16-K012439-022-016-H02-8409
TTTACAATTGAATGTTCAGATTTTTAATACCCGAAACATTGTCTTATAAAGCCCCATTTG
GTGAAATCGTTTTCCTCATCGCAATGTTAAATACAAAGAACAGCAACAAGCGAACTATGG
GATCCTCCCTATAGTGAGTCGTATTACTGGAAAGGAGACCCGAAGGGATGCCATCTGGGC
TCGGCAAAAGTGACGGGCCCGTGAGTTACGATGGTCAGAGGACATATAAATGAGACTCGC
GAAGATGAATCTCTAAGTGGGATGAAACTGATAGTAGGAAAAAGCTAAACACTTGATCAG
AAGACTGAGAGATTTAACAATAGACTCGTACTAATGCTAATGTCTATGGGATCCTCCCTA
TAGTGAGTCGATTTACT
GenBank Accession AL752683 [GenBank]
Graphic View Graphic view of gene At3g10850
Predicted Position of Insertion Chr3:3398817 - go to primer design
BLAST e Value 4e-41
Hit Clone Code (BAC ID) T7M13
Hit Gene Code At3g10850 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Metallo-hydrolase/oxidoreductase superfamily protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 14.10.2014 10:23