SimpleSearch - Line and FST details


Line specific information

 
Line ID 016H10
Vector Used pAC106
Line Availability only available from NASC (N401534)
Segregation Analysis 124:122:91
Confirmed for Hit At5g01900
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g01900

Sequence (A. th genome BLAST matches underlined)
>01-K118237-0022-016-H10C-35St
CAGACCCTTCCTCTATATAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGAT
CAGATTGTCGTTTCCCGCCTTCGGTTTAATGGCTTCTCTTATTCTTTTGTTTTTAAGCCA
TTTGTGTGGTTGAGTACAATGGAGGATTGTAATGGAGTTCTGGTCCTTGGTGTAGGCACA
CTTGTAGTAACTCCTTTGGTACTCAGATTCTTTGATCTGCTTTTGTCCGTATTTCCTCCA
GAGGAAGCCGTCGTGGTAGATCGGGGTTGAAGATTCGTGTCTATGGTAGTCTGAGCTCTC
TGCCATAGATGTCTTTCTGCAACCACATGAGATTCATGATGGTGAGCAATCACTCAAAGA
TAGAACATTTTCAATTTATGAATATGATGTTTATATTCATACCTTCCCCTCTTGTGAAGT
GGTTTCCTGGAGCTCTCAAGCACAGGAGAAGAGTCCTGAGGAGATGAGTTATTGGATTGA
TCGTCTTGGTGGTCATTAGTATCGATCAAGATGGAGAGCGCATCTGAGAAACAATGGAGG
ACGGACTTGGCCAAATCCTCCCTTTCCATGGACGAGTCTGACTCGGTCTGGTCCATGATG
AGCAGCTGGTTGGCGCACCCATGCCCGTGAAGCAACTTCTCCATAGCCTTTTGTTGGCAA
GAGTTCATCTNTTTTTGTTTTTTTTTGAGTAAATACTTATAATTATTGCTCTGTGGGTTT
ATTAAGTTTAGAGATGTGATCCATTGTGTCTCTCTCTCTNTAGATATATATACGAATAGG
TCGAGAAGACGAGATAATGGTCTTGTTACGAAGTTTCGTACGTGTGAGAGAGTTTAGTCA
ATTACTATACACTCCTTCGTTAAC
GenBank Accession HG968576 [GenBank]
Graphic View Graphic view of gene At5g01900
Predicted Position of Insertion Chr5:351501 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T20L15
Hit Gene Code At5g01900 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 62
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Kim et al. 2008, wrky62-1]
Other FSTs Supporting this Hit BX572115 [GenBank]


Last Updated on 07.07.2016 14:03