SimpleSearch - Line and FST details


Line specific information

 
Line ID 017A01
Vector Used pAC106
Line Availability only available from NASC (N401537)
Segregation Analysis 100:91:67
Confirmed for Hit At1g74700
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g74700

 
Sequence (A. th genome BLAST matches underlined)
>95-K028754-022-017-A01C-3144
CCCGGGGAATCGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGCGTTTGAGATTCGG
TATCGGTAGTGCATGCGAGAGATTATGGACATATCCATATATCTGAGGTCAGGATCCTCC
TTTCTTTGACACCTCTTGTTACTTTCTGTCTCTTGATGGTCATAGAAGATTTCATATATC
CTTAAACTGCAGATAGTAAATCATGCTGAAAAGTTTGAAAACAAAGCAATCCTGCTAATC
CACTTTTCGGCTCGGTATACAGTGAAGGTGTGTCTTCTTTATCCAACCTGGTTATGAAGC
AGTAGGAAATCAGTTACTCTCTTACCTTGTAGTGGTAATTAATCTTTGCGAGTTTTCACA
GGAAATCGAAGATGCGGTTTCTGCATTGCCTCCACCTTTAGAGGGACGTGTGTTTGCACT
AACACAAGGATTCTAAACATTATAACACTCTTATAGGTTTTACATACTTTTGTTTTTGTA
TTCCACATGTAAACATTGTATTCTGTTGTTAATTTTAAGATTTCTTCTATCTCGATAAAG
AATGAAGTGTGGAAGTAGAGAATACAGACGAGCACACCAATATCAGATAAATTCAGAGGA
AATCTCATGGGATCCCAAATC
GenBank Accession HG968577 [GenBank]
Graphic View Graphic view of gene At1g74700
Predicted Position of Insertion Chr1:28066743 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F1M20
Hit Gene Code At1g74700 [TAIR] [MIPS] [SIGnAL]
Gene Annotation tRNAse Z1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR395114 [GenBank]

Gene hit At2g23780

 
Sequence (A. th genome BLAST matches underlined)
>01-K013489-022-017-A01-8409
NTTTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGTAG
ATCCCTAAAAAGTAGAGATTTGGACGAAACAAAAGAGGAAACCAGACATCTTGGGAAAAA
ACAGAGTCTTACTGTTGTTGGGAAAGAAAGTTCCAGGCTATATCTGACTTTTGGTTTTTC
CCGTTTTTTTTCCATATATTTTCTTTGGAAGTTTTGATTAATTATTGGGCCGATTATATT
AATTTCTAAACTGATATTGGGCCTGATTAGCTACAACAACACATTTTGGTAGATAAAATG
ATGCCAAAAGCTCGTTTTAAACGTAACCTATGGGATCCTCCTATAAAGGGAAGANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAANNNNNNNNAAAAAANNAAAA
AAAAAAGGGGGGNNNAATATTAAAAAATAAAAAANAATTGATGGGGGGTTATTTAAAGAA
AAAGATTTTTTGGGGATATAAT
GenBank Accession AL752696 [GenBank]
Graphic View Graphic view of gene At2g23780
Predicted Position of Insertion Chr2:10124534 - go to primer design
BLAST e Value 5e-133
Hit Clone Code (BAC ID) F27L4
Hit Gene Code At2g23780 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status unknown
Other FSTs Supporting this Hit AL752695 [GenBank]

Gene hit T16L24

 
Sequence (A. th genome BLAST matches underlined)
>01-K026160-022-017-A01-8409
GAAGCCATTTACAATTGAATACATCCTGGAGGATACTACCGATACTGAAACCCATGAGTC
TGTGAGCCACCCTGTAGTGAGAGCCAGAGGTAATGCTTATGTCGGACCTTAACTTTCATT
TTATAATAACGCTGCGGACATGGGGGGTGATCGGGATACGGTGACGAATGGGAGCCACCC
TATACTGAGTATGTTGAGGCNTGATGCGGTCCACACCTAGCATATATAGTAGTGAGTCCT
TCGAGGCTCTCTACGCTGCCTGTAAACGAGTATGCAAACCCCCTTATTATGAGAGAGGCT
AATATACTTCGCGACGACCCTTGCAGAGGTAATGACTTTGTGATCAACCAACATAGTACA
AAATTGACAGGCACAGATAAGCCGAATCGCAGCACTACCTCTACACCGGAGACCCTTCTC
GTTTCTTAGGTTCACACACAAATGAAGCCGTCATATCCCCCTCCTGACCATATCTACTGG
CTGGCGAACCATGAAGAACAACTGTCAAACACTGA
GenBank Accession FR800474 [GenBank]
Graphic View Graphic view of sequence FR800474 of line 017A01
Predicted Position of Insertion Chr3:22046888 - go to primer design
BLAST e Value 9e-10
Hit Clone Code (BAC ID) T16L24
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23