SimpleSearch - Line and FST details


Line specific information

 
Line ID 017C05
Vector Used pAC106
Line Availability only available from NASC (N401565)
Segregation Analysis 50:49:47
Confirmed for Hit At2g31865
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g31865

 
Sequence (A. th genome BLAST matches underlined)
>35-K026159-022-017-C05-8409
GNAGCCATTTACAATTGAATATATCCTGCAGCCTCATGACTTGTTTCAACACTGATAAAG
CTTGCTGGTCTCTGTGTATGCATACTTCATGTGCGTAGCATAATTGTGTTCTTACCAAAA
ATGAGGCCGCATAACTTTGCCTATCGTCGTTATTACATTTACCTTGACACATGTCTCCTC
CAAAATCCTTATATACCCTCCTCTCCGAAAGCAATACGAGCAATTGAGTAATTCCCAAAC
ATCATACAACACAGGAAAGAATGACAAACTGCCTGAAAGACAAATTTTGATTACCGAATG
AGGGCCTCCCTTTTGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR395154 [GenBank]
Graphic View Graphic view of gene At2g31865
Predicted Position of Insertion Chr2:13547372 - go to primer design
BLAST e Value 4e-21
Hit Clone Code (BAC ID) F20M17
Hit Gene Code At2g31865 [TAIR] [MIPS] [SIGnAL]
Gene Annotation poly(ADP-ribose) glycohydrolase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR800483 [GenBank]

Gene hit At2g23780

 
Sequence (A. th genome BLAST matches underlined)
>35-K013475-022-017-C05-8409
NAATCGCTCCATAGTACACTTCCCTGGACTGAAGTCACTTACAGTTGAATATATCCTGCA
GATGGCCTAAAACGTAGAGATTTGGACGAAACGCAAGAGGAAACCACACGTCTTGGGAAA
AAACTGAGTCTTACTGTTGTTGGGAAAGAAAGTTCCAGGCTCTATCTGACTTTTGGGTTT
TCTCGTTTTTTTCCATATATTTTCTTTGGAAATTTTGATTAATTATTGGGCCGATTATAA
TAATTTCTAAACTGATCTTGGGCCTGATTAGCCTCAACCACACATTTTGGTAGATAAAAT
GATGCCAAAAGCTAGTTTTAAACATAAGCTATGGGATCCTCCCTATGTGAGATTAATGA
GenBank Accession AL752747 [GenBank]
Graphic View Graphic view of gene At2g23780
Predicted Position of Insertion Chr2:10124532 - go to primer design
BLAST e Value 3e-91
Hit Clone Code (BAC ID) F27L4
Hit Gene Code At2g23780 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 14.10.2014 10:23