SimpleSearch - Line and FST details


Line specific information

 
Line ID 017G04
Vector Used pAC106
Line Availability only available from NASC (N401612)
Segregation Analysis 100:94:11
Confirmed for Hit F25P22
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F25P22

 
Sequence (A. th genome BLAST matches underlined)
>31-K013475-022-017-G04-8409
TTTGATCCATGTAGATATTCCCGGACATGAAGACCTTTACAATTGAATATATCCTATTAT
CGCACATTGATTGCATTTGCTATCTGGATTAAAGATTCTCATCGGTCTATACAGATCTAT
GTATTCTACCGCTTAGTATATAAACACTTTGGTAGGAAAATAAACAGTCGTTTGGATTAT
ATTCACGAATATTCTGATTGATGATATTCACTGGTTTCAAATAGTATTAACACTTTTTAC
GTTAAATAGTACCTATTTATGTTACACAAAAGACATATTCTTGCATGATACTTATAATGT
GATGTGACACTATACGAGCTAAATTAATGTCGGCTGTTTATAACTTTTTTTTTTATGGAA
AACCCCTTGGGGCCCCCCCTTTATGGAGAGAGTCAACANAATAGAGCTCCCCCATCGCCC
TATCCCCCGGACAAGAGACCCAATCCCCCGCCATATTTTTGTAAGCACAAAATTTTTGTC
TCACACCCACACATCTCATGCCTTTCGCTTTTTAACACAGCATATCCGAACCCGGTCACC
TTTTCTGTCCGTGCGCCATTTGTTCCCCCGTTTACTTTTACCCCCCACTTAGGGGCGCTC
TACCCTCCCCCCCTTGCCCCCATAACAGGATCCCCCCCCCACGCGCTACAAGCACCCCAT
GCCCCTGCTCATTCCCCGCATACATAAATTTTGCATTACCCAAC
GenBank Accession AL752842 [GenBank]
Graphic View Graphic view of sequence AL752842 of line 017G04
Predicted Position of Insertion Chr1:27759587 - go to primer design
BLAST e Value 6e-77
Hit Clone Code (BAC ID) F25P22
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40