SimpleSearch - Line and FST details


Line specific information

 
Line ID 018C06
Vector Used pAC106
Line Availability only available from NASC (N401662)
Segregation Analysis 50:49:49
Confirmed for Hit At5g03140
Parent of DUPLO pair none
Parent of pair(s) 3233, 5285, 5320, 5349, 5357, 5377, 7022, 10277, 94457

Gene hit At1g22610

 
Sequence (A. th genome BLAST matches underlined)
>54-K017012-022-018-C06T-8409
ACGCTTNCAGTCACCGAGGATAAAAACCAACTTCTCGCTCCACTGAGGGTTTAGATCTTT
AAACCGCGTTTGCGTTCTCTGACGCTGTTCGTCGAATTCAACTTCTACGAAAGGACTCGC
TGAGCCTTGTCCGTCTTTTGGCATCAAATCACTATGGGATCCTCCCNTATAGTGAGAGAG
CATCCGTCTTTCTTCCAAAACATGTTCTCAAGCCTTCCTTTCTGAAACTCAAAAACCTAT
GGGATCCTCCCT
GenBank Accession AL936085 [GenBank]
Graphic View Graphic view of gene At1g22610
Predicted Position of Insertion Chr1:7994814 - go to primer design
BLAST e Value 5e-68
Hit Clone Code (BAC ID) F12K8
Hit Gene Code At1g22610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation C2 calcium/lipid-binding plant phosphoribosyltransferase family protein
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit CR395254 [GenBank] AL936085 [GenBank]

Gene hit At5g03140

 
Sequence (A. th genome BLAST matches underlined)
>43-K013162-022-018-C06-8409
CTGATCCATTGTAGATTTCCCGGACCATGAAGCCTTTACAATCGAATATATCCCTAGTGA
GGATACGTACGTACCGACCAATCGGATCACTGAATCTAGCACGGATCCTATACCGCTCGC
TCCACGCCCGCGGCGCATCCCGCCTATACAGAGCTTGTTTGGAGTCCCCCCAGCTTGGGC
CTATTTGCTTCAAAAGTGCGAGACTCCCAATATTGACGGTGATGTCATAAACATGTAACA
TTATGCTCGGGGCGAATTCCACCCCCAATTTTAGTGATTATGGACTCCCGAGGCAAACGG
AGCACGATAAATCGCCGGACGCAACCGCCGCCGCTGGAACAATGGGGTATTTAGCGCCAG
AGTATTTGCTAACCGGCCGACCGACGGAGAAAACCGACGTTTTTAGCTACGGAGCCGTTG
TTTTAGAAGTATGCACTGG
GenBank Accession AL752912 [GenBank]
Graphic View Graphic view of gene At5g03140
Predicted Position of Insertion Chr5:738560 - go to primer design
BLAST e Value 4e-75
Hit Clone Code (BAC ID) F15A17
Hit Gene Code At5g03140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Concanavalin A-like lectin protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T17H7

 
Sequence (A. th genome BLAST matches underlined)
>43-K013490-022-018-C06-8409
CTGATCCATGTANGAATTTCCCGCACATGACGCACTTTACAATGGAATATATCCTGTGAA
TTATATGATCTAATGACTATCGGATCCTCGCTATAGTGAGAGTTCTATGCCATTTGTTGT
TCTTCCGTGATCGTTCGTCGAACGTCGCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL752914 [GenBank]
Graphic View Graphic view of sequence AL752914 of line 018C06
Predicted Position of Insertion Chr1:10942369 - go to primer design
BLAST e Value 3e-17
Hit Clone Code (BAC ID) T17H7
Insertion Classification Genome Hit
Confirmation Status unknown
Other FSTs Supporting this Hit AL752914 [GenBank]

Gene hit T9J14

 
Sequence (A. th genome BLAST matches underlined)
>43-K026161-022-018-C06-8409
CCGGAATGTAACCATTTACATTGAATATATCCTGCATCCGAGAAAGGTACACTGATAGCT
TAACTTAGACGAGGAAGTATACGATCCGATCCCCGGTGTAGGGGATCCTCCCTATAGTGA
GACTGATTGCTGGGGGCCCTTCCCCGCATCCTTATTAGCAACGGAATTACGGAAACGACC
TGATGAAAGTTCTATTAATTTTCCGCCAGATTAAGCTGGGAGAGAAGCCCCCCCCCCCTG
AGATAGAACAACCCCCCCGGGAGAATCGCTAACAATTTGAAAGAAATTAAACGCGGGTAT
GGGATCCACCCCACAGGGAGTTGTAAAAAAATTAAAGGCGGGGGAAATTTTTATTTTCCA
TTTTGCCATAAAGCTGGAAATAATATTTTCGGTCCCTATTTGAAAAACCTTTTTCTAGAA
AAGGGAAAAAAAAAAAGGGCCATATTGAAAATGCCCAACCTTTTCCTAAAAAAACCCCTT
AGAACCAAAAACCCCCCCAGGTTATTTTAAAAACAATAAATACCTCATTTTTTGGACGAA
AAAAAAATACAAG
GenBank Accession CR395253 [GenBank]
Graphic View Graphic view of sequence CR395253 of line 018C06
Predicted Position of Insertion Chr3:1359151 - go to primer design
BLAST e Value 6e-14
Hit Clone Code (BAC ID) T9J14
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40