SimpleSearch - Line and FST details


Line specific information

 
Line ID 019E07
Vector Used pAC106
Line Availability only available from NASC (N401783)
Segregation Analysis 50:47:37
Confirmed for Hit At3g54510
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At3g22520 can not be ordered because the confirmation of this insertion failed.

Gene hit At3g22520

 
Sequence (A. th genome BLAST matches underlined)
>53-K013491-022-019-E07-8409
TACAGAGTACGAAAATAAAAAGTAGAAGAAGCAGAAGCGAGAGCGCAAAAAGGTTAGATC
TGCTTTCAAATTGTTCGTACTGCTTCTTTACCCATAAAGTTCATAGCTTTTTACGTTTCT
ACCGATAATTTTGCATTCCGAATTCTCCATTTTCTCAATTTTGCTTAAATGGGTGTTTCT
CTTCTGCAGGAAATTAGGTTTTGAGTGGTCATGTCTGCTCCTATCTATTCTCCGATAGAT
ACGCAAGAGATTGTTCAAAATCCTCCTGGGTAATTCTTCTTTTCTGATAACTATGTTATA
AATGTGAACAAAAACTTGTTTTGTCTCTGGTTTGTTTTGGTTATCCTGTGTCTGAATCTT
GGCTTTGATTTCTTGAACAACTTAGACCTTTTGATGGGTTTATGTCCGGAAATGAGACCA
AATTAGTGTTTAGCTGATATCTGTTCAGAATTCTGACCTAAGCACAAAAAGTTCTTGAGT
TTAGATGAGAGAAGATTACATTGTTTAGAGGAACATTTTTGTCTTTGGGAATTGTGTGAA
ACTTACGTTGAGCAAAAGTTAGGGTTCTTATTCTAATTGCTGCTACCATAAAAGATGTGT
CTTTAGGGTTTGAAAGCCCCATATTTTGTTATTCATTATGCCCGAATATGCTTGTCTCAC
CACTACGGTATACTGAAGGGTATA
GenBank Accession AL753101 [GenBank]
Graphic View Graphic view of gene At3g22520
Predicted Position of Insertion Chr3:7974772 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F16J14
Hit Gene Code At3g22520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification TS2TE (5')
Confirmation Status failed, line belongs to a contamination group, please check line 017E03

Gene hit At3g54510

 
Sequence (A. th genome BLAST matches underlined)
>48-K017011-022-019-E07T-8409
TTTCCCGGACTGAAGCCCGTAACGCCGTCGTATACTATGCTCGCCGCCTCTCCGATCGCC
ACCACCACCGTCCTCTGTCTCTACACTCATCCCTTTGCCTCCCTCGTTTCCTTCCTTCCG
TTGCGTGGATCCCACGCGCCTTCCGTGTCCCCGAGGACGAGATCCTCAGCCGCCACGGCC
TTGATGCTCTCGTCCTCATCAGGCTCTTCAAATTCGGGTAAGGAAGATTTGGTCTTATCT
CGCATATAAACACGATTATCAGATTCTTTGAACTATGTGCAGAATTAGATTCTTCCTGAT
GTGTTCGTTACTTGGAGCATCACTACTTCTTCCGGTTGATTATTACAATGAGTCAGATTT
ACCGACACGAAGAGAGTATTCAATGGATGCTTTCACAATATCAAATATCACACGAGGTTC
TAACAAGTAAGCCGTTTCCTTTTTATGTCTTAATTAATTTTGCATCATCTCTCTTAGAGT
TGTGTTTCTTGATATCTTGTCTTAATTTTCCTAGGTTATGGGTGCATTTCTCATGCTTGT
GGTGCATATCATTCTATGCATTGTTTTTGCTGCATAAGGTAAGCTTTTACTCTTGTCTAT
CAGTGACGGATTTTTTTTTGTTATAGAATAGGTTTATTTACTGGATCTTCTCCATCTATG
G
GenBank Accession AL936115 [GenBank]
Graphic View Graphic view of gene At3g54510
Predicted Position of Insertion Chr3:20180430 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T14E10
Hit Gene Code At3g54510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Early-responsive to dehydration stress protein (ERD4)
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL753099 [GenBank]


Last Updated on 07.07.2016 14:03