SimpleSearch - Line and FST details


Line specific information

 
Line ID 021C04
Vector Used pAC106
Line Availability only available from NASC (N401948)
Segregation Analysis 51:21:19
Confirmed for Hit At1g77300
Parent of DUPLO pair none
Parent of pair(s) 1680

Gene hit At1g77300

 
Sequence (A. th genome BLAST matches underlined)
>27-K013749-022-021-C04-8409
NTGATCCATGTAGATTTCCCTGACATGAAGCACTTTTGGCTTTTAATTTCCATTATTTTC
ATGTGTATGCAGGTTCATAATATTGCGCGGAGCTTCCGAGACAGATGGATACCTAAGCAT
TTTAGAAAACCTTGGCGCATCAACAGGGAGGAGAGATCGGAGTCTATGAGGTCACCTATA
AACAGAAGGTTCAGAGCATCACAAGAACCTCGATATGATCATCAGTCCCCAAGACCTGCA
GAACCAACTGCGTTTGTCATATTATCAAAGGCTGCAACTCCTGAAACAGCATCTGCATCT
GAGGGACATCCAGAACCTAATCCCGGTCTTCCTCAGACTAATGG
GenBank Accession AL762147 [GenBank]
Graphic View Graphic view of gene At1g77300
Predicted Position of Insertion Chr1:29041071 - go to primer design
BLAST e Value 9e-147
Hit Clone Code (BAC ID) T14N5
Hit Gene Code At1g77300 [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone methyltransferases(H3-K4 specific);histone methyltransferases(H3-K36 specific)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL762146 [GenBank]


Last Updated on 14.10.2014 10:23