SimpleSearch - Line and FST details


Line specific information

 
Line ID 021G04
Vector Used pAC106
Line Availability only available from NASC (N401996)
Segregation Analysis 100:75:61
Confirmed for Hit At3g17710
Parent of DUPLO pair none
Parent of pair(s) 2641, 88787, 88793, 88800, 88802

Gene hit At3g17710

 
Sequence (A. th genome BLAST matches underlined)
>47-K029744-022-021-G04C-8409
CATTTACAATTGAATATATCCATCAGTGTTATGAGCAAGCCAATAAAGATTCCCGTTCAC
GGACAAAGGATCCTTGTTGGGCCACAGGTTGAAAGGGTTAGGGGTATCAATAAATTTGAA
CGCCTGCGATGCACACTCGTAGATCGCAGCTTGGTAGTAACCTTCCTGGAGAGAGTCGCT
GAGTCTACGCGTACAATTAAAATACCCCAAGATCTTGTAACACTTATCGGGTTTACAACT
ATCGTATCCTACACCGCAAAAACGGAAACCTTTATCCTCATACTCGATCCACCCAACCTG
TCTCAACCACGGATTCCAAACCGCAACACCTTGTTTCCAAAAATCACGAAACAATAACCC
ATCGCAAGCCATGATAGTTGTAAAATTCTTCTTCATAGGCTGACAATGAAAATCGTAGGG
TACCTCACGCACCTCTATCGTTCCACCCAGATCGATCTCTATCGAGTACATCTTCTTCGA
TTCGGTAAGGAAGATGAATTGGGGACGGGCACGGACCAAGTGCTTTTTGACAAACCTCTT
GTCGCTGAAAAGACCGTTCCAG
GenBank Accession HG968581 [GenBank]
Graphic View Graphic view of gene At3g17710
Predicted Position of Insertion Chr3:6056226 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MKP6
Hit Gene Code At3g17710 [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box and associated interaction domains-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23