SimpleSearch - Line and FST details


Line specific information

 
Line ID 022A04
Vector Used pAC106
Line Availability only available from NASC (N402020)
Segregation Analysis 100:85:60
Confirmed for Hit At1g73655
Parent of DUPLO pair none
Parent of pair(s) 189

Gene hit At1g73655

 
Sequence (A. th genome BLAST matches underlined)
>92-K018342-022-022-A04t-8409
ATTTCCCGGACTGAAGCCTTTACATTGAATATGAAACATAAACTGTATCAACCTCGATGA
TATAGTCAAGTGTTGCAGATGGAGGAATCTCCAAACCCTGTCCAAATTCGACATTTCTGT
CTCCAAATCCTAAGGACGGTGGAATTATCACTCTACGTTTACCTCCAGCCTTCATTGACC
TGAGAACATGCTCTATACCTTGGCATAGTCCCTTGCTATACGGTCTTGAGTCCATTACCA
TCACTATGGGATCCTCCTTATAGTGAGANNNANNNNANNNNNNNNNNTGCCCTTTTTTTA
TAATTTANAAATGTGTAGCTCCGCGGGGATTTTATAAAACGAGAGTACATTTTGATTAAA
CTACAAATTACGACTCCGGAGTATTGGATAGGCCAATGCAATAAACAACTCATTCTAATT
CGGAAATCTTTATATGGACGAGTCCACGTTCTCGTCCATTGGGGGGCTGAGATGAGAAAC
TTCACGATCGATGCCTAGACTTCCCCATT
GenBank Accession BX285082 [GenBank]
Graphic View Graphic view of gene At1g73655
Predicted Position of Insertion Chr1:27690489 - go to primer design
BLAST e Value 3e-112
Hit Clone Code (BAC ID) F25P22
Hit Gene Code At1g73655 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FKBP-like peptidyl-prolyl cis-trans isomerase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL936123 [GenBank] BX285082 [GenBank]


Last Updated on 31.08.2016 09:40