SimpleSearch - Line and FST details


Line specific information

 
Line ID 022F04
Vector Used pAC106
Line Availability only available from NASC (N402080)
Segregation Analysis 102:55:37
Confirmed for Hit At3g28910
Parent of DUPLO pair none
Parent of pair(s) 3592, 9744

Gene hit At3g28910

 
Sequence (A. th genome BLAST matches underlined)
>30-K013751-022-022-F04-8409
TGATCCATGTAGAGTTTCCCTGTACATGAAGACCTTTACAATTGAATATATCCTGGCCTT
TTGATATGATAATGACTTTTCAATTACTCTAATTTTGTCTCTTCCACATTTTCTTTCGAA
AATTAGAAGATTTGTTTTGATTTTTAATAGAGAGCATTTAATATTTGGTGTAGATGGGCT
GCAATTGCGTCATATCTTCCACAAAGGACAGACAATGACATTAAGAACTATTGGAACACT
CATTTGAAGAAGAAACTCAACAAAGTCAGTCAAGATTCTCATCAAGATCTTGACCGTTCC
TCGCTCTCATCTTCACCATGGGCTTCTTCTGCTAATTCCAACTCAAACATCTCAAGAGGC
CAATGGGAAAGGCGACTTCAAACCGATATCCACTTGGCGAAAAAGGCTCTCTCTGAGGCT
TTATCTCCTGCCGTCGCACCAATCATTACATC
GenBank Accession BX890717 [GenBank]
Graphic View Graphic view of gene At3g28910
Predicted Position of Insertion Chr3:10912032 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MLD15
Hit Gene Code At3g28910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 30
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX890716 [GenBank] BX890717 [GenBank]


Last Updated on 31.08.2016 09:40