SimpleSearch - Line and FST details


Line specific information

 
Line ID 022G12
Vector Used pAC106
Line Availability only available from NASC (N402100)
Segregation Analysis 50:49:46
Confirmed for Hit At2g15300
Parent of DUPLO pair 2702
Parent of pair(s) none

Gene hit At2g15300

 
Sequence (A. th genome BLAST matches underlined)
>95-K013726-022-022-G12-8409
TTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACATGAAGCAATTCCACGACAAG
AAGCATGTGCACGGCAACATCAAGGCCAATAACATTCTCTTGGACTCCGAGTTTGAGCCT
GTAATTACAGATATGGGCCTTGATCGTATTATGACTTCGGCCCATTTACTCACGGACGGG
CCATTGTCGAGCTTACAAGACCAACCACCAGAGTGGTCGACAAGCCAGAAGCCAAACCCC
AAATGGGATGTATATTCATTTGGTGTTATACTCTTGGAACTTCTCACAGGCATAGTTTTT
TCGGTCGATCGAGATTTGGTTCGCGATTCTGAGACTGATGAGAAAAGTTGGTTCTTGAAG
TTGGTCGATGGGGAAATTAGGGTTGAGGTGGCTCACCGCGAGGATGAGGCGGTCGCATGC
TTGAAGTTAGGCTATGAATGTGTCTCCTCCTTGCCTCAAAAGCGACCGTCTATGAAGGAA
GTGGTGCAAGTGCTATGGGATCCTC
GenBank Accession AL762320 [GenBank]
Graphic View Graphic view of gene At2g15300
Predicted Position of Insertion Chr2:6651547 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F27O10
Hit Gene Code At2g15300 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23