SimpleSearch - Line and FST details


Line specific information

 
Line ID 024B05
Vector Used pAC106
Line Availability only available from NASC (N402225)
Segregation Analysis 100:77:71
Confirmed for Hit At5g56270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g56270

 
Sequence (A. th genome BLAST matches underlined)
>06-K028757-022-024-B05C-3144
GACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGA
AGTTCATTTCATTTGGAGAGGACAGGGTACCAGCTTTGCAATTCATACAGAAGTGAGAAA
AATGGCTTCTATGATATCCTCTTCAGCTGTGACTACAGTCAGCCGTGCTTCTACGGTGCA
ATCGGCCGCGGTGGCTCCATTCGGCGGCCTCAAATCCATGACTGGATTCCCAGTTAAGAA
GGTCAACACTGACATTACTTCCATTACAAGCAATGGTGGAAGAGTAAAGTGCATGGTGAC
GGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGA
CCCCGTGGGAGATTCGACAGACAAGTCACAACTAACAATCAGTCTCCTTTTAGCCGTCCC
TTTAGCTTTCAGCCACATTTGGGTCCTCCTTCTGGTTTCTCCTTCGGTTTAGGACAAACC
GGTTTGGTTAATCTTTCAATGCCTGGTTTAGCGTATGGTCAAGGGAAAATGCCGGGTTTG
CCTCACCCGTATATGACACAACCGGTTGGGATGAGTGAAGCAATGATGCAGAGAGGGATG
GAACCAAAGGTTGAACCGGTTTCAGATTCAGGACAATCGGTATATAACCAGATCATGAGT
AGATTACCTCAGATTTGAAATTTACTCTTCTTCTTCTTCTTCTGCATTTGGTCACTCCTT
ATAATAACTTTTAATT
GenBank Accession HG968593 [GenBank]
Graphic View Graphic view of gene At5g56270
Predicted Position of Insertion Chr5:22782823 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) K24C1
Hit Gene Code At5g56270 [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX546517 [GenBank]


Last Updated on 14.10.2014 10:23