SimpleSearch - Line and FST details


Line specific information

 
Line ID 024B09
Vector Used pAC106
Line Availability only available from NASC (N402229)
Segregation Analysis 100:99:77
Confirmed for Hit At1g75430
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g75430

 
Sequence (A. th genome BLAST matches underlined)
>96-K028754-022-024-B09C-3144
GGGTACCCGGGGATCAGATTGTCGTTTTCCGCCTTCGGTTTAAACTATATTCATCATCGT
TTGAATGGTGTCTGGGATCGTTGCAACAAACTGAGAAGCTTTGTGATTTTGATATGAATC
TCATGATTCTCAGGCAAAGACATGAAACCAGAACTGCAAAGTTCGGATTTGATTTCGGAA
GACAAAGCAAAACCGGGTCTTCTCCTTCCTGGAAACAGCTGATTGATTAGAATGTTGTTG
CAAAGCTCAACCTCTCTACCACCTATATCGATAACTTCTTCTACAAGGCATTGCACTGCC
TTAGCATATCTTGAATCCAACAAAGTACCACGGAGAGATGAACACTCATGTCTTACCCTA
AAATCCTCCATCTTCTTCTACTTGTTGAAGAGGAAAAATAATGCAAATAAAAAAAAAAAC
TTTTTGGGTTCTTGTTTTGTTACTCTTTTTTGCTCCACATACATAAAATAAGTAACCAAG
AAGCAATCAATATATATTATTCAGATTCATTTTCTAAAAATTTGAAGTTGACTTG
GenBank Accession HG968594 [GenBank]
Graphic View Graphic view of gene At1g75430
Predicted Position of Insertion Chr1:28309226 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F1B16
Hit Gene Code At1g75430 [TAIR] [MIPS] [SIGnAL]
Gene Annotation BEL1-like homeodomain 11
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23