SimpleSearch - Line and FST details


Line specific information

 
Line ID 025B05
Vector Used pAC106
Line Availability only available from NASC (N402321)
Segregation Analysis 100:88:64
Confirmed for Hit At2g23180
Parent of DUPLO pair none
Parent of pair(s) 769, 5704, 7627, 7640, 8704, 10407, 95639, 95651, 95660, 95668, 95671

Gene hit At2g23180

 
Sequence (A. th genome BLAST matches underlined)
>34-K013722-022-025-B05-8409
TTGATCCATGTAGATTNTCCCGGNACATGAAGCCTTTACAACTTTCCCGGTCTTAAAGTT
ACAGTCACTAAGAGATCTAATTTGCTCTGAATATTATGCATTACTATTGTACTACATTTA
GTATGAAAATAATTATTAGAATTTTACAAAATACTTGAATAAGAGGGGTAATGTTTACAA
TAAAATTAATATTTACTCTTCTTAGAATGCTATGGGATCCTCCCTTAGGTGAGACGNCAC
CCCTGGGTCTAACACACCCCCAAGCTGCCTCACCGGGATCGAATCGGGCTCACCTCGGAT
CAGGAACAGCTACAATATACGCCGCTTAAACAAGCAGATTATAGGAAAGAGACCCATCTA
TCTAAGGCTAAAAGAAGGGAAAGAAGCCGCAGCTATGGGATCCTCCCTTAAGTGA
GenBank Accession CR356251 [GenBank]
Graphic View Graphic view of gene At2g23180
Predicted Position of Insertion Chr2:9876462 - go to primer design
BLAST e Value 3e-85
Hit Clone Code (BAC ID) T20D16
Hit Gene Code At2g23180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 96, subfamily A, polypeptide 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR356251 [GenBank]


Last Updated on 31.08.2016 09:40