SimpleSearch - Line and FST details


Line specific information

 
Line ID 025B05
Vector Used pAC106
Line Availability only available from NASC (N402321)
Segregation Analysis 100:88:64
Confirmed for Hit At2g23180
Parent of DUPLO pair none
Parent of pair(s) 769, 5704, 7627, 7640, 8704, 10407, 95639, 95651, 95660, 95668, 95671

Gene hit At2g23180

 
Sequence (A. th genome BLAST matches underlined)
>88-K028756-022-025-B05C-3144
GGGTAACCCGGGGATCAGAATGTCGTTTCCCGCCTTCGGTTTAAACTATCAGAGTTTGCT
TCATGTGAAGAATAATAGAAGGAACTGGCTCGATCTTGTGTCCTTCAACGACCTTTATCT
CATAGTTTTGTATAATTTTCACAGCCACTGTCTTCATCTGTGTCATAGCCACTTCTTTCC
CCAAACAAGTCCTTGGACCGGCATTAAACGATAAGAACTTAAAAGAAGGCACGTGAATCA
ACCTTCCACTCTCTGAAATCCATCTCTCCGGTTTAAATTCCGATGCATCTTCTCCCCAAA
CTGATTTCATTCTCCCTAATGAGTAAAGACAGAACACAATCTTCGAACTCGCATCGACTC
TGTGTCCACTTGGAAGAACGTCGGATTTTGTAGGAGACTTGTGCTGAAATGGAACCGGTG
GATATAGCCTAAGGGCTTCACACAATGCTCCATGTACATACACCAACTTGTTTAACTCTT
GAGCATTGAATGAATCAAAATCATTGGTTCTTGGAGATAGTTGTGTGTTGATTTCTTGAC
GAATCTTGGTTATGGCTTT
GenBank Accession HG968596 [GenBank]
Graphic View Graphic view of gene At2g23180
Predicted Position of Insertion Chr2:9876460 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T20D16
Hit Gene Code At2g23180 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 96, subfamily A, polypeptide 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23