SimpleSearch - Line and FST details


Line specific information

 
Line ID 025D01
Vector Used pAC106
Line Availability only available from NASC (N402341)
Segregation Analysis 90:68:63
Confirmed for Hit At1g66780 At2g05890
Parent of DUPLO pair none
Parent of pair(s) 6019, 10491, 11016, 91589, 91604, 91619, 91620, 91621, 91622, 91623, 91625, 91626, 91627

Gene hit At1g66780

 
Sequence (A. th genome BLAST matches underlined)
>08-K028757-022-025-D01C-3144
GGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCAT
TTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAA
ACTATCAGTGTTTGATGAGAAATCTGAAGATCAGACGAGTTATTATTTGTCAACAGAGAT
GATGAAGAAGGTAAGCTTCATGGCTGCACCAATGGTGGCTGTGGCTGCTTCTCAATACCT
CCTTCAAGTTATCTCCATTGTTATGGCTGGTCACTTGGACGAGCTTTCTCTCTCAGCCGT
TGCTATTGCCACTTCTCTTACCAATGTCACCGGCTTCAGCCTCATCGTAAATTCCTCCTC
CTCCTCCTCCTCCTTCTCTCTCGACTTATAGACCTGTCCAAAGGACAAACATGCTAAGCA
AAAAATTAGGGTCGCCAAATTTTTTTTATTTTTAAATATTAATGCAACTTCACTTTTTTT
AGTAGTTATATCTTTAGGACTACCAATTTTTTGTTTTGATAGAAACTTACACCTTTTCAA
AGTTATGGGAGTGTACACATTTCTTGTTTCATAACTAGGACCACTATTTTTATTGGACCG
ACTTTGCTGACTTAGATCGTTAGTTTGGATTGGCAGGTGCGTTAGAGACACTGTGTGGTC
AAGCTTTTGGAGCTGGGCAATTTAGGAATATCANTGCATACACTTA
GenBank Accession HG968597 [GenBank]
Graphic View Graphic view of gene At1g66780
Predicted Position of Insertion Chr1:24909271 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F4N21
Hit Gene Code At1g66780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation MAtE efflux family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX572120 [GenBank]

Gene hit At2g05890

 
Sequence (A. th genome BLAST matches underlined)
>04-K013757-022-025-D01-8409
ACAAACTAATCTAAGACTACTAAAAATGTAATAAAAATGTTAGTATGATAAATAAATTAA
TGAATTGTACATCAGAAGATGTGAGGACTTCCTTGATTGTTTCGCCTTGGATAATCACCA
TCGTCATCCCCAGTTCTTGGTGCATAGAGCCTCTTGTGAAAAGATCCAGAACTTCCCAAA
GTTAACCCATCAGTTGGTATGCTATATATCAAGAAAATATAGTTTGCTTAATATTATGTA
TAAAAAAATATATTTAGTGACAAATAAATACAATTACCTTTGCTTAAAAAGATCCAACTC
AGCCAACGTGGGATCCACGAAGACTTGTGAAACATCAAAAAAATTGGAAACACTCCTATG
GGATCCTCCC
GenBank Accession AL762506 [GenBank]
Graphic View Graphic view of gene At2g05890
Predicted Position of Insertion Chr2:2254810 - go to primer design
BLAST e Value 5e-164
Hit Clone Code (BAC ID) T6P5
Hit Gene Code At2g05890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transposable element gene
Insertion Classification TS2TE
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03