SimpleSearch - Line and FST details


Line specific information

 
Line ID 027B02
Vector Used pAC106
Line Availability only available from NASC (N402510)
Segregation Analysis 100:88:81
Confirmed for Hit At1g78130
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g78130

 
Sequence (A. th genome BLAST matches underlined)
>92-K028756-022-027-B02C-3144
TCTATATAAGGAAGTTCATTTCATTTGCAGAGGAACAGGGTACCCGGGGATCAGATTGTC
GTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTAAAACTATCATTTTAAAATGTACATGT
CACACGAATAGTTTTCCCGTGTGAGAACCCAATGAGTTCCAACCACATAGGTGCAAAAGA
AAGAGCAGACCAAGGAAACGATCCTGTCACTCCCTGAGCTACAATGATCTGAAAAGACCG
AATCTTTATGACAGTATCAGCTTCCCGGACCAAATCCTTCACCTCTGTACAAAAAGGTTT
CCTCGAACCTGGTTGATTCGAAACATCAACACCATCCTTCACAAAATGTGGATCATTGGC
GAAAACTCTAACTAGCACACCAACAATAACACTGATCACACCTACGATATGGAA
GenBank Accession HG968602 [GenBank]
Graphic View Graphic view of gene At1g78130
Predicted Position of Insertion Chr1:29401041 - go to primer design
BLAST e Value 3e-160
Hit Clone Code (BAC ID) T11I11
Hit Gene Code At1g78130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Major facilitator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX572122 [GenBank] HG968602 [GenBank]


Last Updated on 31.08.2016 09:40