SimpleSearch - Line and FST details


Line specific information

 
Line ID 027F07
Vector Used pAC106
Line Availability only available from NASC (N402563)
Segregation Analysis 89:58:30
Confirmed for Hit At5g36290
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g36290

 
Sequence (A. th genome BLAST matches underlined)
>54-K013728-022-027-F07-8409
CTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGGCTAC
ACATGTTGCATGAGAACAACTTACTTCCTCCAGTTTCTTTCTTCTGATTGGACTTTGAAT
CAGAAAACCTCCAAGCAATGTAGAGGAATACCACACCACAAAATGCATAGAGCACTGCAT
TTTCAAAGATGTAAGATCCTGCATGTGAGATTGGGATTACTAAGATAGAGCCGCCAAAAC
TTACAAGTAAGTGCACCAATTCCAATGATAATACAGATATCTACTCTTAACATTTAAGTG
TTTTACATATTCACAAAAAAAGACATGAAGAAATCAGTTTGGATAGCTACTTTTCTACTA
AATGAATCAATTATCCTACCATTTCACCATGTCAAATAAACTTAGATACTAAGATATACA
GTTCAAGTAAACCGGAGCTGCAAAATCATAATCACAAGACACACTAAAAGATTGGTGGAC
AAGGTTTAAGCCTCGGACAGAACATTTTCCATAAGACAAAAATTCATGATCGTATAGTTG
CATAGCACTCTCAATTCATTTAAGCTATGGGATCCT
GenBank Accession AL762741 [GenBank]
Graphic View Graphic view of gene At5g36290
Predicted Position of Insertion Chr5:14304374 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T30G6
Hit Gene Code At5g36290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Uncharacterized protein family (UPF0016)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03