SimpleSearch - Line and FST details


Line specific information

 
Line ID 029D07
Vector Used pAC106
Line Availability only available from NASC (N402731)
Segregation Analysis 43:42:35
Confirmed for Hit F16P2
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F16P2

 
Sequence (A. th genome BLAST matches underlined)
>52-011559-strizhov-D7-oriL
CTTGAATCATGTAGCATTTCCCGGACATGAAAGCATTTACAATTGAAAAAACAACATGCT
AAAGATCAAAGAACATTAGTTGAATCAATCCTTATTTTGAACAAAGAATAGTCAGTCCAT
TTTGTTCACCTGAAACGCAAACGCCACCTTTGTATGGTAATACAATCATACAAATCTCAT
ACACACCAAAAGAAACACAAAATCACCAAAACAAAATCTTTATATTTATTTCTTTTTTCC
TTGATTCTCCTTATTAAAGAAAAAAGATTATTCTTCTTCACCCGTCACAAGCCACAACGA
CTTATTTTAGATTCCCATACAAAAAAGAAAATTCCACATCTATAAAACATCTCCTCCCAT
ATTTGCTGGATCATCCTTAATTGCCTGTGTTCATGTCTTCATATCTCTAACCATAAGATA
AAACTCAAGATTTCTGAAGAGGACAGCTCTGGAATTCATATACGTTTTGCCTCTCCATCT
GATTCTCAGGTTTGTTTCTTGTCTTAAAAGAAACACANAATGGGTTTATTTGAATCTTTT
AATCATAAAAATACTTAAAGAAAGAGGATCAAATGTTGATTTAGATCTCTAATGAAAGTT
TGTGTAACGTATAAACAGCTTATGGGATTGGAGCAAATCTGGCTTTTGAAACCCGATGAT
GAAGAAGAAAGGGAGTCCCCATACCATCGAAAACAGAAGAAAATTTAGGCGGGGGTTTCT
TTGTCTTGCGGCGTTACCAAAACAAAACAATTGCGTTTCCGAGACGAAAGAACGCGAAGA
ATCGACTA
GenBank Accession AL762895 [GenBank]
Graphic View Graphic view of sequence AL762895 of line 029D07
Predicted Position of Insertion Chr2:12616247 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F16P2
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23