SimpleSearch - Line and FST details


Line specific information

 
Line ID 029D07
Vector Used pAC106
Line Availability only available from NASC (N402731)
Segregation Analysis 43:42:35
Confirmed for Hit At2g29410
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g29410

 
Sequence (A. th genome BLAST matches underlined)
>52-011559-strizhov-D7-oriL
CTTGAATCATGTAGCATTTCCCGGACATGAAAGCATTTACAATTGAAAAAACAACATGCT
AAAGATCAAAGAACATTAGTTGAATCAATCCTTATTTTGAACAAAGAATAGTCAGTCCAT
TTTGTTCACCTGAAACGCAAACGCCACCTTTGTATGGTAATACAATCATACAAATCTCAT
ACACACCAAAAGAAACACAAAATCACCAAAACAAAATCTTTATATTTATTTCTTTTTTCC
TTGATTCTCCTTATTAAAGAAAAAAGATTATTCTTCTTCACCCGTCACAAGCCACAACGA
CTTATTTTAGATTCCCATACAAAAAAGAAAATTCCACATCTATAAAACATCTCCTCCCAT
ATTTGCTGGATCATCCTTAATTGCCTGTGTTCATGTCTTCATATCTCTAACCATAAGATA
AAACTCAAGATTTCTGAAGAGGACAGCTCTGGAATTCATATACGTTTTGCCTCTCCATCT
GATTCTCAGGTTTGTTTCTTGTCTTAAAAGAAACACANAATGGGTTTATTTGAATCTTTT
AATCATAAAAATACTTAAAGAAAGAGGATCAAATGTTGATTTAGATCTCTAATGAAAGTT
TGTGTAACGTATAAACAGCTTATGGGATTGGAGCAAATCTGGCTTTTGAAACCCGATGAT
GAAGAAGAAAGGGAGTCCCCATACCATCGAAAACAGAAGAAAATTTAGGCGGGGGTTTCT
TTGTCTTGCGGCGTTACCAAAACAAAACAATTGCGTTTCCGAGACGAAAGAACGCGAAGA
ATCGACTA
GenBank Accession AL762895 [GenBank]
Graphic View Graphic view of gene At2g29410
Predicted Position of Insertion Chr2:12616247 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F16P2
Hit Gene Code At2g29410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation metal tolerance protein B1
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences


Last Updated on 07.07.2016 14:03