SimpleSearch - Line and FST details


Line specific information

 
Line ID 030C06
Vector Used pAC106
Line Availability only available from NASC (N402814)
Segregation Analysis 32:13:3
Confirmed for Hit At5g16820
Parent of DUPLO pair 2605
Parent of pair(s) none

Gene hit At5g16820

 
Sequence (A. th genome BLAST matches underlined)
>90-K028754-022-030-C06C-3144
GGGTAACCCGGGGATTCAGAATTGTCGTTTTCCCGCCTTCCGGTTTAAACTATCAGTGTT
TGCACCAGCAGACTCTTGGAGCCCTGAATTTTGATTTAGTTCGGATCGCGAGACAGATAG
TGGAGAGTGTTTTGATCCAATAATGGCTGTTTTAGATGAGTCAGAAGGCGATGCAATTTC
TCCTGAAGGTGAGGGCAAGATGAATGAGTTACTGGAGGGAGTCCCTAAGCTGCCCGGAAT
CCAAGATCCATTCTGGGAACAGTTCTTTTCTGTTGAACTCCCAGCGATTGCAGATACAGA
CGATATTCTATCAGGATCAGTGGAGAATAATGACTTGGTATTGGAACAAGAACCAAACGA
GTGGACCCGTAATGAACAACAAATGAAGTATCTTACTGAACAAATGGGACTGCTTTCCTC
AGAAGCACAGAGGAAATAAAGGTAAGAACATCGTTAAGTTCAAACATGTTTCTCTGCATT
GTTGTATATCTTGAGAGTTATCAATTGTCTCTCACAATGTAGATTTTCAGGGGAGGTTGC
AA
GenBank Accession HG968607 [GenBank]
Graphic View Graphic view of gene At5g16820
Predicted Position of Insertion Chr5:5532123 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F5E19
Hit Gene Code At5g16820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation heat shock factor 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL762927 [GenBank]

Gene hit At5g53000

 
Sequence (A. th genome BLAST matches underlined)
>43-K025962-022-030-C06-8409
NNNTTTGGATTATATCCGGAATGAACCATTTACATTGAATATATCCTGTAACTGGCTTCA
GAGTATGTAAAGCCTCACTAACATGAGATACTGATCATCATCCCCATATAGAGAATCCTC
CCTATAGTGAGATTCNNNNCNCCCTAATCCTCCCCACCATAAGATCAAACTATCCATCCC
CACTATAGTACAATCCTCTAAACATCCTCTATTCAGAATCCAACTACCCATTTCAAATAA
ACACCCAAATCCAATCTGTATATAAAAAACAGGTATAATCTTCCACCTGATCAACACCAT
ACTCTGAAGCAGCAAGATGAATTTTCCTAGCTTGCTCGAATAGCACCGATAAAGGCATTT
CCTCCATAGCCAAACCACCCATCACAGGCAACAATTCAAAATTCCTTAATGAAATCGAAT
CCACAAGAATCGAGTTTCTTCGAGAAGAGGATCGTCTTTTGAATTTTTTTAGGGTTCCAA
ATCGAAATCTGACTAATTTACCACGAGTATGGGATCCTC
GenBank Accession CR395552 [GenBank]
Graphic View Graphic view of gene At5g53000
Predicted Position of Insertion Chr5:21487546 - go to primer design
BLAST e Value 7e-131
Hit Clone Code (BAC ID) MNB8
Hit Gene Code At5g53000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2A phosphatase associated protein of 46 kD
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit CR395552 [GenBank]


Last Updated on 31.08.2016 09:40