SimpleSearch - Line and FST details


Line specific information

 
Line ID 031D04
Vector Used pAC106
Line Availability only available from NASC (N402920)
Segregation Analysis 100:64:54
Confirmed for Hit At4g37730
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g13000

 
Sequence (A. th genome BLAST matches underlined)
>28-K014871-022-031-D04-8409
AGATTTCTCTGAGTTATCGAATATTCTATATATGTAAATGGCCAGTTTGACAATTACCTA
AAATCATATGATAGACATAAATAATTCTACAAATTTTTAAAATAAATTTAAACTAAAAGA
CAATAAAATTACCATTATGTTCACATTTAGTAAATATTTCATGGACGAATTTCTCCACGT
CGATTTTCGAAATCTCATAATTTTCCGGCGCCGGAATATTACGGTGGTCGTGATACCTTA
AGCACCAAATCCAATCCAACCCTTTAAAAGAAATCATGTCCCTTGATTCCTTTCAACATT
ATTCCTACGGCTATGGGATCCTC
GenBank Accession AL762987 [GenBank]
Graphic View Graphic view of gene At4g13000
Predicted Position of Insertion Chr4:7598033 - go to primer design
BLAST e Value 4e-78
Hit Clone Code (BAC ID) F25G13
Hit Gene Code At4g13000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein
Insertion Classification TS2TE (3')
Confirmation Status unknown
Other FSTs Supporting this Hit AL762987 [GenBank]

Gene hit At4g37730

 
Sequence (A. th genome BLAST matches underlined)
>28-K014862-022-031-D04-8409
TGATCCATGTAGATTACCCGGCCCTTTTACTTCTCCGAACCGGGTTTGGTTAATCAATTC
TCGGGTTTCCAAACCGGGTTCACTCCTTGGGAATGGGATTGCTCTGATCTCTTTTTCGTG
GACCAAATGTCTCTTGAACCGGCCATCCCTATGGGATCCTCCTATNAGTGAG
GenBank Accession AL936126 [GenBank]
Graphic View Graphic view of gene At4g37730
Predicted Position of Insertion Chr4:17723998 - go to primer design
BLAST e Value 5e-62
Hit Clone Code (BAC ID) T28I19
Hit Gene Code At4g37730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic leucine-zipper 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR800862 [GenBank] AL936126 [GenBank]


Last Updated on 31.08.2016 09:40