SimpleSearch - Line and FST details


Line specific information

 
Line ID 031D04
Vector Used pAC106
Line Availability only available from NASC (N402920)
Segregation Analysis 100:64:54
Confirmed for Hit At4g37730
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F25G13

 
Sequence (A. th genome BLAST matches underlined)
>28-K113047-0022-031-D04-8409
ATATATGTAAGTGGCCACTTTGACAATTACCTAACCTCATATGATAGACTTGAATAATGC
TACTCATTTTTAAAATAAATTGAGCCTAAAAGACCATATGATTACCATGATGTTCACCTT
TAGTAAATCTTATCCGGACGAATTTCTCCACGATCGATATTCGAAATGGCATAATTTCCC
GGCGCCGGACTATACGGTGGTCGTGATACCTTGCGCACCCAAGCCCATTCCAACGATTTA
AAGAAATCTTGTCCCTTGATACCGTCCACATTAGTCCTACCGCTAACCCGCCCGGCCGCT
ATAAATAATTCTGCAAATTTTTAAAATAAATTTAAACTAAAAGACAATAAAATTACCATT
ATGTTCACATTTAGTAAATATTTCATGGACGAATTTCTCCACGTCGATTTTCGAAATCTC
ATAATTTTCCGGCGCCGGAATATACGGTGGTCGTGATACCTTAAGCACCAAATCCCAATC
CAACCCTTTAAAGAAATCATGTCCCTTGATTCCTTCAACATTAATCCTACGGCTAACCTG
GenBank Accession FR800861 [GenBank]
Graphic View Graphic view of sequence FR800861 of line 031D04
Predicted Position of Insertion Chr4:7597792 - go to primer design
BLAST e Value 1e-97
Hit Clone Code (BAC ID) F25G13
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At4g37730

 
Sequence (A. th genome BLAST matches underlined)
>80-K028756-022-031-D04C-3144
CTCTATATAAGGAAGTTCATTTCATTTGCAGAGGACAGGGTACCCGGGGATCAGATTGTC
GTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTGAAGGGAAAAAGGGAAGAATTGCATTG
TTGGAGCTTGATATTTATGGACAAACCAAGGGGTAATTTGGTCATATTTCCAAAATACGA
TGTAAGACCGTAGACTATACTGTATAAACAGCTTTTGAGTCATGTTGCACTATGGTGGGG
TTAAAAACTTGAAAATTTTTATTTGGCAGAGCCAACTTTTGTAAAAGCAGGAAATATTGT
GTAGGGCACCAATAGCTTGTTTTGGCGTCCA
GenBank Accession HG968609 [GenBank]
Graphic View Graphic view of gene At4g37730
Predicted Position of Insertion Chr4:17723929 - go to primer design
BLAST e Value 6e-127
Hit Clone Code (BAC ID) T28I19
Hit Gene Code At4g37730 [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic leucine-zipper 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR800862 [GenBank]


Last Updated on 14.10.2014 10:23