SimpleSearch - Line and FST details


Line specific information

 
Line ID 033D05
Vector Used pAC161
Line Availability only available from NASC (N403113)
Segregation Analysis 50:46:25
Confirmed for Hit At1g11920 At3g54350
Parent of DUPLO pair none
Parent of pair(s) 6552, 7843, 11426, 85681, 85723, 85780, 85801, 85829, 85835, 85837, 85838, 85841

Gene hit At1g11920

 
Sequence (A. th genome BLAST matches underlined)
>36-K026599-022-033-D05-8409
ATGACATAATGTGGAAGATAAGATCATGAGAGTTACAATTGCGTTCAACCATTTCGGACC
GGGTCTTATTGAGAGAATGCCTAGGTGAGTGTATGGGATCCTCCCTATAGTGAGACNNAN
TNNTC
GenBank Accession CR395692 [GenBank]
Graphic View Graphic view of gene At1g11920
Predicted Position of Insertion Chr1:4024301 - go to primer design
BLAST e Value 1e-42
Hit Clone Code (BAC ID) F12F1
Hit Gene Code At1g11920 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pectin lyase-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g54350

 
Sequence (A. th genome BLAST matches underlined)
>36-K026598-022-033-D05-8409
ATGACATAATGTGGAAGATAAGATCATGAGAGTTACAATTGCGTTCAACCATTTCGGACG
CGGGTCTTATTGAGAGAATGCCTAGGTGAGCGTATGGAATCCTCCCTATAGTGAGAGAAA
AAACACGCAATACATACATACAGAAGCACTAATTTAGTAGAGAAACTTTTTGGCTAGCCT
AGCTTGATATATAAAATGCTATATGAGAGAAGCAATGAACATAATTATCTATCTTGTGGT
GATTGATGAGCCATCTGTAAAAAGACAAAAGGATATTTTTTCAATCATATTATGTTCTCA
TAACTGAACAGAAAACCAAATTTAAGAAAAAATATTTGACAGTCTTTTCCCCGTGGAGAG
AAGCATGATACATACAGATCATCAGTGATCACACAGCAATATATTATGTTCCTCGCGAAA
TGGTATAATTTGTTCTAGAGCAACAATTATACCTTGCCACATCAAGATTGTGTAACTTGT
TTCCCATAATACTATACTATACCGCATATAACACTGGCTTAAGATGTTAAC
GenBank Accession CR395691 [GenBank]
Graphic View Graphic view of gene At3g54350
Predicted Position of Insertion Chr3:20124928 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T12E18
Hit Gene Code At3g54350 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Forkhead-associated (FHA) domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23