SimpleSearch - Line and FST details


Line specific information

 
Line ID 034B01
Vector Used pAC161
Line Availability only available from NASC (N403181)
Segregation Analysis 100:99:77
Confirmed for Hit At2g26670
Parent of DUPLO pair none
Parent of pair(s) 805, 3265

Gene hit At2g26670

 
Sequence (A. th genome BLAST matches underlined)
>02-K015007-022-034-B01-8409
CTGATCCATGTAGAATTTCCCGGACATGAAGCACTTTACAATTGAATAATCAGTGCAGGA
GTATCCTAGGCGAATTTACTGTACCCAGGAGACCTCATGTATCCTTCAACAGTAGGTTCC
CATTTAGCAACAGGACGTTCCTCAATAGATTTAGTCTCTTTCTCACCTTCCTTAGCTTGA
TCTTTAGTATGAAGTCTCATAGCCACAAACCTCATCTCCTCCACAAAACCCTTTGATTCT
CCAGGATACCTCTTCTTCTGCTTCTCTGCCGCAGTAGTAGCCGCAACCACCACTAAAGAC
GGCGACTTGTTCATGGTCATACTCAGAATCTGAATCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL763127 [GenBank]
Graphic View Graphic view of gene At2g26670
Predicted Position of Insertion Chr2:11342220 - go to primer design
BLAST e Value 1e-136
Hit Clone Code (BAC ID) F18A8
Hit Gene Code At2g26670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plant heme oxygenase (decyclizing) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g25754

 
Sequence (A. th genome BLAST matches underlined)
>02-K015037-022-034-B01-8409
CGTCTCTCTCTTCCCAATCATCTCTTCGTTTCAGATTCCCGCCTTTACATCGCCGACGTG
CAGCTTCGTCGCCAACTAACTCAACTCAACCCCCCCTGCAGTTTCGTCCTCTCACAGTCT
CTATGGGATCCTCC
GenBank Accession AL763128 [GenBank]
Graphic View Graphic view of gene At5g25754
Predicted Position of Insertion Chr5:8953436 - go to primer design
BLAST e Value 2e-46
Hit Clone Code (BAC ID) T5I5
Hit Gene Code At5g25754 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNA polymerase I-associated factor PAF67
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 07.07.2016 14:03