SimpleSearch - Line and FST details


Line specific information

 
Line ID 034C01
Vector Used pAC161
Line Availability only available from NASC (N403193)
Segregation Analysis 100:91:76
Confirmed for Hit At1g11720
Parent of DUPLO pair none
Parent of pair(s) 124

Gene hit At1g11720

 
Sequence (A. th genome BLAST matches underlined)
>03-K015037-022-034-C01-8409
NTGATCCATGTAGATTNTCCCGGACATTGAAGCCTTTACAATTGAATATATCCTGACCTT
TTATTGTAATATAGCTTCACTGTATCTTCAGCCTTGAAATCACTCGGCTCAATGTACCAA
ACATTCTCAGCCGAGACTACAGCTTTCTTAATAGCCGGTTGAAGCAATTCACGTCTCTTC
TGAGTCTCCGCCTTTGCTTGTGCTCTATCAGCTTCAATTGCAGCCTTTTGAGCTTCGATT
CTTCTCTTCTCTTCTTTTTGCCTCTCCCTCTCAGCTTCTTCCTTGGCTAACTTCTCTTGC
TCTCGCAGTTTCTCTTCTATGGGATCCTCC
GenBank Accession BX649660 [GenBank]
Graphic View Graphic view of gene At1g11720
Predicted Position of Insertion Chr1:3953478 - go to primer design
BLAST e Value 2e-92
Hit Clone Code (BAC ID) F25C20
Hit Gene Code At1g11720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation starch synthase 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03