SimpleSearch - Line and FST details


Line specific information

 
Line ID 034C03
Vector Used pAC161
Line Availability only available from NASC (N403195)
Segregation Analysis 50:47:34
Confirmed for Hit At1g78290
Parent of DUPLO pair none
Parent of pair(s) 3145, 59033, 92570, 92571, 92572, 92573, 92574, 92575, 92576

Gene hit At5g14370

 
Sequence (A. th genome BLAST matches underlined)
>19-K015007-022-034-C03-8409
NTGATCCATAGTAGATTATCCCGGACATGACAGCCTTTACAATTGAATATATCCATGCAT
ATATCTTAAAGAGAAACGGCAAAACCGTCTTTTCTCTAAGCGGATTCAATATCAAGTTCG
TAAACTCAATGCCGAAAAACGTCCTCGTGTTAAAGAAAGCTTTTCTCCTATGGGATCCTC
CCTATAGAGAGAGCGAAAAAGAAAGAATCGTTCCCAATTTTTTTTCAATTCAAAAATGTA
CAGGACCCCACCGTTA
GenBank Accession AL763148 [GenBank]
Graphic View Graphic view of gene At5g14370
Predicted Position of Insertion Chr5:4632441 - go to primer design
BLAST e Value 3e-42
Hit Clone Code (BAC ID) F18O22
Hit Gene Code At5g14370 [TAIR] [MIPS] [SIGnAL]
Gene Annotation CCT motif family protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At1g78290

 
Sequence (A. th genome BLAST matches underlined)
>19-K015037-022-034-C03-8409
NTGATCCATGTAGATTATCCCGGACATGAAAGCCTTTACAATTGAATATATTCAGTGCGT
AGTGTCATAAGGAGTATACCGTCTATACGCGCCTATTCTACTAAACGGATTGTATACTAT
ACACTCTTAGACGCATATGCCGAAAAACGTGCTGGTGATAAAGATAGCTGATCTTGTACG
GGAACCTCCCTGTAGCGAGAGGTCGCTGATCCATCCCAATATAATAAGATTCAAGGAGGT
ATAATACAACAATGTCTTCTCTTTTGATGTTACTTTATCTATCAAATTGATAATTGTGTG
AAAACATAGGTTTTATTGACGGCAACACATTTGGCGTTAGTAATGGAATACGCCGCCGGA
GGAGAACTGTTCGGAAGAATCTGCAGCGCCGGAAGATTCAGTGAAGACGAGGTTTAATTT
TATCAATTCTGTCATTATTATCTAAATAAACATTTGTTTTAAAAAGAGAAAGAACCTAAA
AGTCTTGTAAGAAACATTTTTCAGGCAAGGTNTTTTCTTTCAGCAGCTTATATCAGGAGT
TAAATACTGTCAACAGTCTTGGAAAAAACATAACATTCTAGCTTAATCAAAAACG
GenBank Accession AL763149 [GenBank]
Graphic View Graphic view of gene At1g78290
Predicted Position of Insertion Chr1:29458808 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F3F9
Hit Gene Code At1g78290 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23