SimpleSearch - Line and FST details


Line specific information

 
Line ID 034C06
Vector Used pAC161
Line Availability only available from NASC (N403198)
Segregation Analysis 100:87:82
Confirmed for Hit At1g75130
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g29410

 
Sequence (A. th genome BLAST matches underlined)
>43-K015007-022-034-C06-8409
AGATTATCCCGAACATGAAGCACTGCGTTAATAATATATACATTCTCTGCAAAACCCTAT
GGAATCCTCCCTATAGTG
GenBank Accession FR801000 [GenBank]
Graphic View Graphic view of gene At4g29410
Predicted Position of Insertion Chr4:14470182 - go to primer design
BLAST e Value 2e-06
Hit Clone Code (BAC ID) F17A13
Hit Gene Code At4g29410 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal L28e protein family
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At1g75130

 
Sequence (A. th genome BLAST matches underlined)
>43-K015037-022-034-C06-8409
NTGATCCATGTAGATTTCCCGGACATGTAGATTACAATTTCGCGTAGTGTTCATGAAGCC
ATTCGTGGTAGTAGAGGCGCCACACGGTGGACAGAACTCATGAGGATTTCTCCCGGAAGG
AATCGGCTTTGACTTCGCCTCCGCCGTTAGCCGGCTAACCTCGCCGGAGTTTCCACTGAA
TATCCGGTAGCTATGGGATCCTCC
GenBank Accession BX649662 [GenBank]
Graphic View Graphic view of gene At1g75130
Predicted Position of Insertion Chr1:28201657 - go to primer design
BLAST e Value 2e-58
Hit Clone Code (BAC ID) F9E10
Hit Gene Code At1g75130 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 721, subfamily A, polypeptide 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23