Line specific information

Line ID 034H05
Vector Used pAC161
Line Availability available from GABI-Kat
Segregation Analysis unknown

Gene hit At3g11460

Sequence (A. th genome BLAST matches underlined)
>40-K015037-022-034-H05-8409
ATCTCTCCCATTCCATGCATCCCATAGCAACCAATCGTGGCGGTCCATGAAACTAAGCTT
TTTACAGGCATGATGTCGAAAACAGCACGTGCCTTTGCCAAGTTACCGCATCT
GenBank Accession AL763230 [GenBank]
Graphic View Graphic view of gene At3g11460
T-DNA Border 306 base(s) before start of sequence
BLAST e Value 8e-56
Hit Clone Code (BAC ID) F24K9
Hit Gene Code At3g11460 [TAIR] [MIPS] [SIGnAL]
Gene Annotation pentatricopeptide (PPR) repeat-containing protein
Insertion Classification CDSi
Confirmation Status unknown