SimpleSearch - Line and FST details


Line specific information

 
Line ID 035A11
Vector Used pAC161
Line Availability only available from NASC (N403275)
Segregation Analysis 100:91:70
Confirmed for Hit At2g14910
Parent of DUPLO pair none
Parent of pair(s) 10094, 10098, 10099, 10104, 10123, 11269, 92948, 92958, 92959

Gene hit At2g14910

 
Sequence (A. th genome BLAST matches underlined)
>81-K015008-022-035-A11-8409
TGTCCTGTAGATTTCCCGGACATGAAATTGGTTACGCAAGTTTTTTTGGACACGAAAGGA
GTTTGCTTTTAAATCCTTCAATCTAATCCTTTCCTCCTATAGAATCCTCCCTATAGTAGA
AGAGNNNNNNGNTNCNNNTTNNCCCTTTTTTTTAAGGTTAAAAATAGGATGGGGCCCACA
TCACAATGAAAAAAGACAANGTATCCTAATGAATAGGTATTGACGAGAGAGCATACCCAG
TCGTCCTTGAAGATACCATCCGCGGAGACATAGGTTCCCAAGGGGACTCAACATGAACCT
GCAACCCTATCAGATGGAGGAACACCCATCACGCCCGAGAATGATCTTTCCATTGCATCC
AAAGTAAAATCTGAGCAATCCCGCCGAATCAAACTCACATCCAAAGGAGTAATCTCTTGA
ATAAAATCAGAAAGG
GenBank Accession AL763251 [GenBank]
Graphic View Graphic view of gene At2g14910
Predicted Position of Insertion Chr2:6408401 - go to primer design
BLAST e Value 2e-33
Hit Clone Code (BAC ID) T26I20
Hit Gene Code At2g14910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation MAR-binding filament-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g01930

 
Sequence (A. th genome BLAST matches underlined)
>81-K015038-022-035-A11-8409
NTGATCCATGTAGATTATCCCGCACATGAAAACCTTTTACAATGATATATATATCACGAT
TTAAGCACGGCATTATAAAACTCCTCTTTGATAAATTCTCCCAACATTGATAACTCCCCA
ACTCTATGTAATTCAAGCTTCCAGTTTCCACTATACCTAAAGGCTAAAACTAAGCTATGG
GATCCTCCCTTGAGTGAGAGNNNNNNNNNNNNNCNTNNCTGNTNNCTTNNNNNCGNNTAC
AACANTCACCTTTCCTCATATCATTCCAAGGCAACATATGATGCTTGTGGATCAACGGCA
GTGACACTCCCTCACAATCCATGGTCAAAAATTGGATCTGAAATCTCAAAACTCAAAAAT
CTTCTCTCGGTAATCTCAACGATCGATGCTCTTATAAAATTAATCGGAATAAATATAAAT
GGAAGAAGAGGTCTCTCCGCCCCTAATGAGAGGAAAAGGCCATTGGGCTA
GenBank Accession BX942849 [GenBank]
Graphic View Graphic view of gene At4g01930
Predicted Position of Insertion Chr4:840497 - go to primer design
BLAST e Value 4e-115
Hit Clone Code (BAC ID) T7B11
Hit Gene Code At4g01930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cysteine/Histidine-rich C1 domain family protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 31.08.2016 09:40