SimpleSearch - Line and FST details


Line specific information

 
Line ID 035F11
Vector Used pAC161
Line Availability only available from NASC (N403335)
Segregation Analysis 100:87:81
Confirmed for Hit At1g32090
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F21A14

 
Sequence (A. th genome BLAST matches underlined)
>86-K015038-022-035-F11-8409
ATGTAGAGACCAAAGCCAAGACTATATGGACTTTGGCTCACCATGAAAGCTAGAGAAGCA
TGGCATCCTCCTATAGTGAGAAAGGGGCGCCGAGAGGGTGAGAGCCCCGTCGTGCCCGGA
CCCTGTCGCACCACGAGGCGCTATGGGATCCTCCCTATAGGGAGANNNNNNNNNCNNGCN
NCNCCACCCAAAACGGNCTGTGCGAGAGCGAATATAACTCCACATAACAGCCACGAGAGA
ATAACTTTGAGTGCCACCTTAAAAGGAACCATTGGATATGCAAAACGCCGATAGCGCGAC
ACTCTTATTCTTTGCGAACGGGAGTATTACAACTAACGGACCACCACAACCACCCTCGGT
GATAGCCAGACCTTATCCGAAAAATGTAACGCAAAGACGACACCCTCCTCGGGTTCAACC
CCCCACCAAGAAAATAGTGTTAAAAAACGGACAACGACGGGGACGCGTGACCCTGGCGAA
ACCCCCCGCCGCCAACACCAAAATTAACTGCATAGAAACTAGCTCGCGCGTGAAATATAT
ACTTATACAAGCCACCATGATTTCGGCCTAAATTCCTTTCCACGTTTAATGCAGTATCCC
CGTCCCGAACACCCATCCCCCGCCCCTCTTCACCAACCCCACTCGCCGACAACATTAACC
CGCAAACTTTAACGGGGCAACATTCCCCCAATTAACCCACCCACGATTTCGAACATTAAT
TCTTTACCCCGTAAACCAAAACTTGACACGAATCAGAACGACAAAGATTTAAAAAGTTAC
TGCTAGCGCTACCTCGGACCTACAGATCCACCACAAGTA
GenBank Accession AL763309 [GenBank]
Graphic View Graphic view of sequence AL763309 of line 035F11
Predicted Position of Insertion Chr3:14200269 - go to primer design
BLAST e Value 3e-23
Hit Clone Code (BAC ID) F21A14
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g32090

 
Sequence (A. th genome BLAST matches underlined)
>86-K015008-022-035-F11-8409
CATGAGCATTTAAATTGATATGACCTAACCCAATTTCCTAACCTTTAAGNCCGAACCAAA
GTCAGCTAACAAATAACCTAAACCTATTGAATCCTCCCTATAGTGAGAGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNGNGGGGGGCCGNNGGCGAAAAAAAGAAAG
NGGGGGGAAAANAGGAAGGGGAGGAGGGAANNAGAGNGAGGAGGGAAAGAGGAAAAAAAA
GGGGAGGAGGGAGAGGGGAGGGGAAGGGGGGGAGAAAAGAAACACAAAAAAAGGGAGGGG
GAGGGAGGGCGGAGCGAGCGGGACGCGCCGCGATGGTTTTCGCCGACCGACAACAGGAAG
GGGCCAGCAAGTTCTCCTCTTATTCCCCCTCTCTAACCTCCCTGATCTACACATCTTATT
TGTTCATTCCCACACTCTCTTCTCCCTCCTCTCTATCTTGGGTCCTGTGTGCTTCAAATC
AACACTATTTTCTTACCCGCGCATCTTCCGTCCTTTTCGTCACTCTATAGCCGCACGTTT
GGTTTACGTTACTCCTACCTCTTACCCGGCCTTTATTCTCTATTCCGTGATATTCCCAAG
CTCTACCGGTGTTGCTCCGTTCTTCGTCCCCTCCTCGTTCCAATTTATATTTTGTCGCCC
TCTCCTCCATATTGATACCATATTTCCCACCCTTTCTCCCCCGATTGCTGGCTACTTTCG
GTTTATGGTTCCTTACAATATAATTTCCAATTCATTCCTCTTCTT
GenBank Accession AL763308 [GenBank]
Graphic View Graphic view of gene At1g32090
Predicted Position of Insertion Chr1:11540122 - go to primer design
BLAST e Value 2e-15
Hit Clone Code (BAC ID) T12O21
Hit Gene Code At1g32090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation early-responsive to dehydration stress protein (ERD4)
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03