SimpleSearch - Line and FST details


Line specific information

 
Line ID 036D10
Vector Used pAC161
Line Availability only available from NASC (N403406)
Segregation Analysis 50:36:35
Confirmed for Hit At2g31310
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g31310

 
Sequence (A. th genome BLAST matches underlined)
>84-K035342-022-036-D10C-8409
GGAATGAGCCATTTACAATTGAATATATTTACATGAAGCCATGTAGATTGCTCAACAAAT
GCCACAAGATCTTCACAATTGGTTTCACCAAGGAATCTTGGACTCAGACTTCGACCCAAT
GAGTGGTACTACACGCGACAATGAGCGGTCCATGGATCATAATGAGTCTCCTTGTAGCTC
AAATGAATCACTTAATTACTACCAGGAGGTCAATTTTCCTTGGTCTGTTTGAGTACAAGT
GACTACTTTGTCAGAGATGGAACCTTACAATCTTTCTATTGTATCGACTTTTCGACATTT
TTCATAGTAGAGATCGAATCATGCAACCATTTTCTCTTTGAGAATAACCACTTCTTCGAT
GATCTTTCATAGGTACAACATCAGATCTGAACAAGTGTCAAGTCTTAAGAAGTGTCATTA
CTGAGAAAAAGCATAACAAAATGTAGTGTACGCTGTTTTAAAACCAGAAACATC
GenBank Accession HG968620 [GenBank]
Graphic View Graphic view of gene At2g31310
Predicted Position of Insertion Chr2:13353469 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F16D14
Hit Gene Code At2g31310 [TAIR] [MIPS] [SIGnAL]
Gene Annotation LOB domain-containing protein 14
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL763379 [GenBank]


Last Updated on 14.10.2014 10:23