SimpleSearch - Line and FST details


Line specific information

 
Line ID 036E11
Vector Used pAC161
Line Availability only available from NASC (N403419)
Segregation Analysis 100:96:92
Confirmed for Hit At1g35515
Parent of DUPLO pair none
Parent of pair(s) 3276

Gene hit At1g35515

 
Sequence (A. th genome BLAST matches underlined)
>05-K118495-0022-036-E11C-35St
TTCGCAGACCCTTCCTCTATATAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGG
GGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTGACACATATTAAAC
CTTACAACATTGGATCAACTAAAATATAGTCATCCATATTACATAAAAAACCAACAAGTC
TAACTTATAAGCAGAGGCCCATAAAGAAAGCCCAAACCAGGAAACAAAACCTTTAGAGGA
AGTAAATTAAAGATTCCCTTCCACCACAAAGCCACGTGTGATGTTAACAAACAAAGTTGA
AACACGTTGACTGAAGAAGCCTTAGTTGTCGCCATTCACCACCGTTCTGGTTAGCAACTC
AGGGAACTCTAAAACCACCGGAAACCGCCGGAGCTTCAAGAGAAGTCCATTGATTTTTAA
TTAGAGAATCCACCAAACTTCATTAGCAAATTTGGAAAGGAAAGATCTCCCAAAGGCAAT
TGATTCCTGAAATCTAAAGAACATCGACGTAGAGTAAGCCGATGGAGCTTTCAGCAACAC
CTTAAAAAAGAACAAAAAAGCACTCGTCTCCATAGATCAGTTAGAGAAACAGCCACAATT
GCAATAGTTTCAACCCATAAGCATAAAAAACCTTAATCCGCATCTTAATTTGTTCTCAAA
AAATGAAATCGATNAGCGT
GenBank Accession HG968621 [GenBank]
Graphic View Graphic view of gene At1g35515
Predicted Position of Insertion Chr1:13079693 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F15O4
Hit Gene Code At1g35515 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation high response to osmotic stress 10
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03