SimpleSearch - Line and FST details


Line specific information

 
Line ID 036F01
Vector Used pAC161
Line Availability only available from NASC (N403421)
Segregation Analysis 50:46:34
Confirmed for Hit At1g53110
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g53110

 
Sequence (A. th genome BLAST matches underlined)
>06-K015001-022-036-F01-8409
AATTGGATCCATGTAGACTTTCCCTGGACATGAAGCCTTTACAATTGAATATTCAATTGA
ATATATTGATGTTTTCCATTTACATGTCTACATCCACAGAAGAAGATTTACATACAGCCT
TCTTCTTCTTCGCTCTCTTATCAAGCTCCTTACGTTTCTTCTCAGCTTCCTTCTTAACTC
TTATGACAGCTTTAGCAGCAGCTTTCTCATGTAGTTTCCTCTTCCTTTCCATCGCTATGG
GATCCTCC
GenBank Accession AL763396 [GenBank]
Graphic View Graphic view of gene At1g53110
Predicted Position of Insertion Chr1:19791803 - go to primer design
BLAST e Value 5e-22
Hit Clone Code (BAC ID) F8L10
Hit Gene Code At1g53110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation proton pump-interactor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR801029 [GenBank]


Last Updated on 07.07.2016 14:03