SimpleSearch - Line and FST details


Line specific information

 
Line ID 038A07
Vector Used pAC161
Line Availability only available from NASC (N403559)
Segregation Analysis 102:98:90
Confirmed for Hit At4g07960 At2g13130
Parent of DUPLO pair none
Parent of pair(s) 3957, 3968, 3969, 4151
Note Although the line exists, the insertion in At2g35570 can not be ordered because the confirmation of this insertion failed.
Although the line exists, the insertion in At1g77130 can not be ordered because the confirmation of this insertion failed.

Gene hit At4g07960

 
Sequence (A. th genome BLAST matches underlined)
>48-K028183-022-038-A07t-8409
AACCGAAGGCGGGAAACGACAATCTGATCCCCGGGNTATGGGATCCTCCCTATAGTGAGT
CGTATTACTCACCCTCCATTTGATAATATCCGCGGCGGACAACACTGCGAGACATCTTAA
CGTTGTTACCACCTGAGCAACGGCATATAGAAAAAAAATACCTAAAATACTTTCTAAATT
TTGGTATTATATGTGGTTAATAGGTGGGGGGTGGATATTTACCGNTACCNAANCCATAAA
TTTAATCACCAATACCCCTTCATTCNCATGAAGCTTCTTTGCTCCCCATTCCACTCATTC
GGTCTCTGTTGTAATAGCCCGGCAGTGANTAAGGTTGTATGATAACTACTGTGTCTTATA
AGGAAGAAAAGGGTTCGATAATAATNAATAGGTCTCACTATAGGGAGGATCC
GenBank Accession CR769994 [GenBank]
Graphic View Graphic view of gene At4g07960
Predicted Position of Insertion Chr4:4803455 - go to primer design
BLAST e Value 2e-17
Hit Clone Code (BAC ID) F1K3
Hit Gene Code At4g07960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cellulose-synthase-like C12
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR769994 [GenBank]

Gene hit At1g77130

 
Sequence (A. th genome BLAST matches underlined)
>49-K030267-022-038-A07-8409
ATTCCTTCATCCCATCGAGATTACTTTGTTTCTGGGATTCATATACAGGTTTCAAGCTGA
TAATAAAAAAACAAAAGAACATATCCAACCCACATTTGGTTGGCGAAAGGCAGAGTAATT
TGTATGGGATCCTCCCTATAGTGAGTCGTATTACTCACGGCCTTTGGGAACCTCCGTTTA
GGAAATCGCAGCTGCCCTCTTTTTTTGGGATTCTCCTTTGGCGAATTTTTTTTTTTTTTT
GTTAGGTATTTTTTTTTTTATCCTTGTTTTGGTTCCCCTTTTTGGGTTTTTTGTTTTACT
TCCTTTTATAATTCGTTGAAAGAGATTTTTTGGCGCAAACCTCTGGTGATAANCCCCATT
GTGAAAAAAAACCCCCGACAAATAAAAACCCGGGCCAAAAG
GenBank Accession CR934174 [GenBank]
Graphic View Graphic view of gene At1g77130
Predicted Position of Insertion Chr1:28978919 - go to primer design
BLAST e Value 3e-37
Hit Clone Code (BAC ID) T14N5
Hit Gene Code At1g77130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plant glycogenin-like starch initiation protein 2
Insertion Classification TS2TE (3')
Confirmation Status failed, line belongs to a contamination group, please check line 159A05
Other FSTs Supporting this Hit CR934173 [GenBank]

Gene hit At2g13130

 
Sequence (A. th genome BLAST matches underlined)
>48-K028184-022-038-A07t-8409
TTTCTTTCTCTCCACCGATCCAGTAAGTATTACCATTGAAAGACACACCAGCAGAGAATA
TTCCCCAAGTGATAGCATCATCAATAACCCTTCCACAATCAGATCCAAAATCAAAGATTT
CAAACTCAGCTACACGAAGATTTTCTGTTAACGTATCCAAGAGCATAGCCATCATTATAC
CGGTAACAAGTTCCACCTTCTTTGACCCGTATGGGATCCTCCCTATAGTGAGTCNTATTA
CTCNC
GenBank Accession CR769995 [GenBank]
Graphic View Graphic view of gene At2g13130
Predicted Position of Insertion Chr2:5420187 - go to primer design
BLAST e Value 8e-114
Hit Clone Code (BAC ID) T17A11
Hit Gene Code At2g13130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g35570

 
Sequence (A. th genome BLAST matches underlined)
>49-K015215-022-038-A07-8409
CTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGTTGCCATCTACATACC
AAGTTTAAGGACCACAAGTTTTGTCTTGTTTTGACTCTGTAACAGAGGAGTGAGACAAGT
GAGAGAGAAGTAAGTGTAAGGCTAAGGGTTTGGGAAAACAGAGTGAACATAAGAGAGAGA
GAGCTTTGTAAGTTCCTATGGGATCCTCCATTTAGGTGAG
GenBank Accession AL763565 [GenBank]
Graphic View Graphic view of gene At2g35570
Predicted Position of Insertion Chr2:14931717 - go to primer design
BLAST e Value 7e-58
Hit Clone Code (BAC ID) T32F12
Hit Gene Code At2g35570 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification CDSi
Confirmation Status failed


Last Updated on 31.08.2016 09:40