SimpleSearch - Line and FST details


Line specific information

 
Line ID 038B01
Vector Used pAC161
Line Availability only available from NASC (N403565)
Segregation Analysis 100:78:54
Confirmed for Hit At5g05690
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g05690

 
Sequence (A. th genome BLAST matches underlined)
>11-K029742-022-038-B01C-8409
ATTGAATATATTTAAAACATGCGCCGGTGGTCCTTCAAAAAAACGGTTTGCATGCAGATG
CAATGTAGTGAACACTGAATAGATCGAATCTTAATTTTTTAATATCTTTTCCAAAACACT
AAATCTTGTTGATTCGCAATCAAACCAACTACATAACACCTAAAATTTCATTCATACGTG
TCGTGTTTTTCATTCGCTGTGTATACTCTTTTAAAAATAATTCAATCAAAATTCGATACT
AAAATCGAATATTTTTCTCAAAGTTATTCTTTATTAATTAAATACGAACCATGTATATAA
ATAAGTAGAGAGATTATTTACCAAAAATGGGAAAATTACCTTGAGTTGAGCAAGAGCTAA
AGGAGTCTCGGTGAGAAATTTGACGGCGAGAGTCATGATCGTGGAGGTTGTTTCATAACC
GGCGACAAGTAAAGCC
GenBank Accession HG968624 [GenBank]
Graphic View Graphic view of gene At5g05690
Predicted Position of Insertion Chr5:1705186 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MJJ3
Hit Gene Code At5g05690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cytochrome P450 superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HG968624 [GenBank]


Last Updated on 31.08.2016 09:40