SimpleSearch - Line and FST details


Line specific information

 
Line ID 038C07
Vector Used pAC161
Line Availability only available from NASC (N403583)
Segregation Analysis 100:88:59
Confirmed for Hit At2g46400
Parent of DUPLO pair none
Parent of pair(s) 1384
Note Although the line exists, the insertion in At4g19510 can not be ordered because the confirmation of this insertion failed.

Gene hit At2g46400

 
Sequence (A. th genome BLAST matches underlined)
>51-K015215-022-038-C07-8409
NTTGTGATCCATGTAGCATTTCCTCGGACATGAAGCCTTTACAATTGAAAAAAAAACAGA
GGAATCTTACACATGAGCACAGTTTGGAACTGAAAGAGAGACAAAAAACCAATCTTTTAG
CTCAATTTACCTCTTTTTGAAGACGTTTTTAGAATCTTTTCCATCGATCTCAAGGCTTCG
CTTAAGGATGTTCTTGTCTTGGTTGAAGCTCAACATGAAAATGGCATTCTGGTAAATACG
GAGGATATCACAGATCAAGGTTTTGTTGGAATCGACAGAAGAAGTGTGTTTGAGATTGTT
CATCAATCGGTTAGCAAGCTCTTTCCCTATGGGATCC
GenBank Accession BX649667 [GenBank]
Graphic View Graphic view of gene At2g46400
Predicted Position of Insertion Chr2:19044442 - go to primer design
BLAST e Value 1e-145
Hit Clone Code (BAC ID) F11C10
Hit Gene Code At2g46400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 46
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g19510

 
Sequence (A. th genome BLAST matches underlined)
>51-K030267-022-038-C07-8409
TACCAGAAGAANTAAACCNNCTGTAGATATGATGAAAGGAATCCTAGNGAAGA
GenBank Accession FR801075 [GenBank]
Graphic View Graphic view of gene At4g19510
Predicted Position of Insertion Chr4:10635729 - go to primer design
BLAST e Value 5e-05
Hit Clone Code (BAC ID) F24J7
Hit Gene Code At4g19510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Disease resistance protein (TIR-NBS-LRR class)
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 038B07


Last Updated on 07.07.2016 14:03