SimpleSearch - Line and FST details


Line specific information

 
Line ID 039A05
Vector Used pAC161
Line Availability only available from NASC (N403653)
Segregation Analysis 100:33:22
Confirmed for Hit At1g76550
Parent of DUPLO pair 12560
Parent of pair(s) none

Gene hit At1g76550

 
Sequence (A. th genome BLAST matches underlined)
>33-K015216-022-039-A05-8409
AACCTGTTTCTTAATGAATGGAGGCACAAACTCAAACAAAGCAGATGACCAAGATGACAC
CTGAGTAGAAATATTATTAACCTGCACACCCTCCTTAAGCAATCCATGAATTTCCTGCAT
CGCACAACAACATGTAAATGCTTACTATGCTTTGGAACTCATGTTTTATTAAAAAATAGC
ACATTAAATGATAAATAAAAATGTTTGCCAGTATTGAATCGCTACCTTCAACAGAGCATA
GAGTTCACGAATACTCTCAACAAGCCCTTCAGGAATTACGATGACTCCATGATTTTTGTC
TGATACAAATAGACAGTTTATCAATAAAGTTAGGGAACAAGCAAAAGACATCACTTCCAA
CATACCAAAAGCTTGTTTTACTTATCAGACCTTGTTCGGCTCTTGCTTGAACAGCATCAC
AGATTTGTTTTATGATGTCAAATCTTGCGAGCTTAGATGCTGCACCCTCCTCACCCCAGT
ATCATCTGAGACAATCGCATCAAATGCAAATGATAAACTA
GenBank Accession AL763657 [GenBank]
Graphic View Graphic view of gene At1g76550
Predicted Position of Insertion Chr1:28724136 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F14G6
Hit Gene Code At1g76550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phosphofructokinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL763657 [GenBank]

Gene hit At5g47090

 
Sequence (A. th genome BLAST matches underlined)
>33-K030268-022-039-A05-8409
CCGGAATGAAGCCATTTACATTGAATATGTCCAGGAAGATTAAACCGAGGGCGGGAAACA
AGAATCTGAATACCCGGAATATGCGATCCTCAGCTAGGTCGATCCGTCTGAATGGTAAAG
AACAGAAAGAGAAGGCAACAACAGTCTTACCGCCAGAGGAGATGCAAGATATGATGGATC
AGTTCACATCAATCATGGAACAGAAGTTCTTATCGGGAGAAGATCATCAACATTTGGATT
ACGCAAAGATAGACAATGACGAGACTCTTGATGATCATTGGCTTCGAGAGATTGGCCGTG
ACGCTGAAGATAAGTATGGGATCCTCCCTATAGTGAGTCANATTGCGCACCCCCCCTAAT
TAGGGGTAGAATGGTCTCCCTATAGGGAGGATCCCGTTCCCCAGCGTTAT
GenBank Accession CR934252 [GenBank]
Graphic View Graphic view of gene At5g47090
Predicted Position of Insertion Chr5:19128200 - go to primer design
BLAST e Value 6e-116
Hit Clone Code (BAC ID) K14A3
Hit Gene Code At5g47090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation coiled-coil protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 31.08.2016 09:40