SimpleSearch - Line and FST details


Line specific information

 
Line ID 039B06
Vector Used pAC161
Line Availability only available from NASC (N403666)
Segregation Analysis 50:48:48
Confirmed for Hit At4g15370
Parent of DUPLO pair none
Parent of pair(s) 5595, 5612, 5629, 5690, 10383, 91762, 91771, 91782, 91795, 91801, 91808, 91815, 91818
Note Although the line exists, the insertion in At1g21380 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g21380

 
Sequence (A. th genome BLAST matches underlined)
>42-K030253-022-039-B06-8409
AGCCATTTACCAAGAAGAGTATACCTGAGTGCAGAAGCATCCTCACTTTGCAGAGAGGCC
TGAATAGCAGCATCTTCATCTGATGCAGTTGCCTGAGCAACAATAGGCTGAGTCTGAGGT
GGAGTAAAGAACGGTATGGGATCCTCCCTATAGTGAGTCGTATTACTCCCTCTCTTTTAA
GACTTCCCTTTCGAACATCTTTGTTTTCCTCGTCTTTTTTCCTTTTATTTTTTTTTTTTT
TTTTCTGCTCTTTTTGAAGAGACTTTTTTTTATTTCTTATTTTTTGT
GenBank Accession CR934266 [GenBank]
Graphic View Graphic view of gene At1g21380
Predicted Position of Insertion Chr1:7487112 - go to primer design
BLAST e Value 7e-63
Hit Clone Code (BAC ID) F24J8
Hit Gene Code At1g21380 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Target of Myb protein 1
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 163C01

Gene hit At4g15370

 
Sequence (A. th genome BLAST matches underlined)
>75-K029747-022-039-B06C-8409
GCCATTTACAATTGAATATATCCTGCTCCCAACACTAAAATTTTACATTTATAGTTAAAA
CATGAATTATCGATCCAACAATGATTGAAAAAATAAAATCATGGTGCATAGGTGATATGT
CTGTACATCACTGGACATCTTGAGAAAATCTTCACTCACGAGCATCGTGTAGAGTTACTT
CGGTACATGTACAACCATCAGGTACATCTATAAATATCTCGTGTGCACACACATACATAG
GGTGCAAATATTGTGTGTAAATGAATGACCAGAAACAACTTAGTCGACAAAAAAAAAAGT
TTATTATTCAACTCATTCCTCTGCGAAATAGTAAATAAATTAATGAGTTGAACAATTTTC
TTTTGTATTTTGTTTATTTTCCCAATTATTGTTGGATGAGTTGAATCATTTTTACACTTA
TTCAACTCAAATGATGAAAAATTAGATGAATGGTCGTTAAACTCTTTCAA
GenBank Accession HG968628 [GenBank]
Graphic View Graphic view of gene At4g15370
Predicted Position of Insertion Chr4:8779179 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g15370 [TAIR] [MIPS] [SIGnAL]
Gene Annotation baruol synthase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23