SimpleSearch - Line and FST details


Line specific information

 
Line ID 039D05
Vector Used pAC161
Line Availability only available from NASC (N403689)
Segregation Analysis 50:8:7
Confirmed for Hit At3g12460
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g12460

 
Sequence (A. th genome BLAST matches underlined)
>50-K118834-0022-039-D05C-35St
CTTCGCAGACCCTTCCTCTATTAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCG
GGGATCAGATTGGTAATTACTCTTTCTTTCATGTTTTGTTTCTTTTCAATTTGGTAATTA
CTCTTTCTTTCTTCTCCTTTTGCAATCGTCGGAGGCTAGTTAAATTGTAGTACTGGTGCT
CGCTATCACCATTGATCTTTTTGAAAATAAATGCAGTTAAATTTGGACGGTTGAGATGCA
GTGTGACGTCATTAACCTACGCCAAACCTTAATGGTTATTACTGATTTGAATTCAAAAAG
AATTTCTTATAAAGATCTCGAAATTTGAATTATGGAGAATATTTTGAGTATAGTTTATCA
GATTACGTTAGCTAATGTTATATACTCCTAAAAATTAGTATTATCCTAAATCAAGATTAG
GATTGATAAACGCATCTCAGTTGTAAACTCGTATCCTTGATCTTGCTTGAGGTTATATCC
AGTTTAAAAATCGGAAATCATTTAACTGGGTGCAAAAACATTTGATTGACCAATTTGGTA
CGTCGTGATTTTTTTTGTCCCATGTCAAATTAAACAAAATTGATAATATAATTCATCAAA
GCGTATTTGTTTTTAATCAAAACGTTAGATAGTCTTTTAATATCAATGCCTTTATTACAA
ACGTAGTCTACATGTACTAATTTTCCAGTCAACATTCATAGTCACAAAATACGATAACAT
GAAAACTTTCATGAATTAGAAGAAGACGTTGATTGATAAAGAGAGAAGAACAACAACAAA
TTCAAATCACAAGATTAGCAGCAACTTTTAA
GenBank Accession HG968629 [GenBank]
Graphic View Graphic view of gene At3g12460
Predicted Position of Insertion Chr3:3955468 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T2E22
Hit Gene Code At3g12460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Polynucleotidyl transferase, ribonuclease H-like superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL763685 [GenBank]

Gene hit At3g00840

 
Sequence (A. th genome BLAST matches underlined)
>36-K030268-022-039-D05-8409
AGCCATTTACATTGAATATATCCTGATCACCGGGTATTTGCATCCGCCCGACGCATGAGC
CGTACTAATCTTTGAGAATGGGAGCCTCCCGAGAATGAGCCCCATTCCTTGATGAAACCC
ACCCTAATCGGAAGCAATACATCCTTCGGTAATTGAGCTGCCATATTTTGCTAATCTCTG
ATGTCTGATTCTGGGGGAGGTCTCGAGCTCCCATATGAAACGATGCATCCATGTGTACCA
CCGGAACTCGATGAATATTGGTTATTTGAGATCCACCCACTAAAGAGAAGACTCGTTACT
TAAGTTAAATGATAGTGACATGATTAAGAGAATATTAGCTATTAGGTCGGAAATAAGAGA
AATAAGACTGGTAGTGGTATGGTTATGTAAATTATCAGTATGGGATCCTCCCTATAGTGA
GGACCGGGG
GenBank Accession CR934287 [GenBank]
Graphic View Graphic view of gene At3g00840
Predicted Position of Insertion Chr3:18006036 - go to primer design
BLAST e Value 3e-59
Hit Clone Code (BAC ID) T8P19
Hit Gene Code At3g00840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation novel transcribed region
Insertion Classification TS2TE
Confirmation Status unknown


Last Updated on 31.08.2016 09:40