SimpleSearch - Line and FST details


Line specific information

 
Line ID 040A09
Vector Used pAC161
Line Availability only available from NASC (N403753)
Segregation Analysis 100:97:74
Confirmed for Hit At3g60130
Parent of DUPLO pair none
Parent of pair(s) 1423, 5942, 5946, 5956, 69892, 69930, 69969, 70008, 70011, 70026, 70030, 70031, 70032, 70035, 70038

Gene hit At2g06540

 
Sequence (A. th genome BLAST matches underlined)
>65-K030269-022-040-A09-8409
TGGATCACATGGATCCTTCAAGTATGGGATCCTCCCTATAGTGAGTCGATATTACTCATC
CTCCAGTACGATCATCCCAATCATGAAACGTATTGTAAACCCTGCGTCTCAGAAACAGAA
ACCACTGATCATCTCTTTTTCACATGCCCTCATGCAATACAAATTTGGCGGGCATCGGCA
ATACCCATCCATGAACTCACTGATTCCCAGATCAGCTTGGAGACGAAAATGACGGCTCTA
TTTGAATGGCACCAAGAAGTATGGGATCCTCCCTATAGTGAGTCGAATTACTCACTCCTT
ATTACAATTACCCTTTCTAATATCCCTTTTTACATATNNANTTTTAATTTAAAAAT
GenBank Accession CR934355 [GenBank]
Graphic View Graphic view of gene At2g06540
Predicted Position of Insertion Chr2:2593383 - go to primer design
BLAST e Value 6e-85
Hit Clone Code (BAC ID) T12H3
Hit Gene Code At2g06540 [TAIR] [MIPS] [SIGnAL]
Gene Annotation transposable element gene
Insertion Classification TS2TE
Confirmation Status unknown

Gene hit At2g36970

 
Sequence (A. th genome BLAST matches underlined)
>65-K030254-022-040-A09-8409
TGGATTACAAAACTAAGGCAAACCACACCTAACGCTCTCTAGAATTGAATTCCATCCACA
ATGTGTGAAAAACCCTCCCACGGCCGGATTTGAAATAACTTCCATCTGGCAGCACCATTG
GACCACAAGACCTCGATCTTGGGCTTGGTCCACAAACCCGGCTGGAAGAAAATCTGGTAT
GGGATCCTCCCTATAGTGAGTCNTATTACTCACTCTTTTT
GenBank Accession CR934354 [GenBank]
Graphic View Graphic view of gene At2g36970
Predicted Position of Insertion Chr2:15530506 - go to primer design
BLAST e Value 3e-87
Hit Clone Code (BAC ID) T1J8
Hit Gene Code At2g36970 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At3g60130

 
Sequence (A. th genome BLAST matches underlined)
>65-K015218-022-040-A09-8409
TTGATCCATAGTAGATATCCCGGACATGAATGCCTTTACAGTTGTTAACATACATACAAA
AAAGAACCAAGTGGACAAAAGAATAAGAACTAAACCTGATAAGCAGAAGTAGCAGATCCA
AAAACGAAATCTTGTGGGAAATCATTTCTTCTTAACCTATGGGATCCTCCCTATAGTGAG
AGGAAAAAAAGAAAGAGTATTTACCAATTTTTTTTTAATTCAAAAATGTAGATGTCCGCA
GTGTTATAATACNCCCACCCCCCTTTTTTCCCACATAACATTCCAACCTTCAACTTCGCG
GACCCCCTACCCCCCCCACACCGGTAAAAAACACCGTAACCCCCACAAATCACCCTCTCC
CCCCTCCTCACTAACCTCCCCCCCACCACCCCCCCCCAAACACAATGGACCCACCCTCAA
GCAACAAGCGGCGCAAAATCCCTGCCCCCCCTAAGATAATATCCATTTTCCATCTGACCA
GGACCCCCCCGGTGTTCTCGAACAATTAGCCACCCCACCCGCCCACCCTTTTTCACCGAC
CCCCAACCACCCTTAGACATCAATGACACCCATAATACACGGTGACACATCAAACAC
GenBank Accession BX649668 [GenBank]
Graphic View Graphic view of gene At3g60130
Predicted Position of Insertion Chr3:22210541 - go to primer design
BLAST e Value 2e-52
Hit Clone Code (BAC ID) T2O9
Hit Gene Code At3g60130 [TAIR] [MIPS] [SIGnAL]
Gene Annotation beta glucosidase 16
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23