SimpleSearch - Line and FST details


Line specific information

 
Line ID 040C05
Vector Used pAC161
Line Availability only available from NASC (N403773)
Segregation Analysis 100:72:50
Confirmed for Hit T12G13
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At2g26510 can not be ordered because the confirmation of this insertion failed.

Gene hit T12G13

 
Sequence (A. th genome BLAST matches underlined)
>64-K028183-022-040-C05t-8409
AGCCATTTACAATTGAATATATCCTGCCTGCTATCCTCAGCGATCTGAGTAGAAATGTCT
GGATGGACTGCTGACCTGACTGCCTCCTTCTCTGCTATTGGCGATCGAGTATGTTGGTGG
AAGTGTGACTTTCTGTTCTGTTTTTCCTCTTTCTGAGCACCAATAGCTCCAAAACACCTG
AAACAACTCCAGAATGCAGAATGTATGCAAGACTAGTCCTACACTCGACTAAAGATGCAA
AATGTATGGGATCCTCCCTATAGTGAGTCGTATTACTCACTCCCTTTTT
GenBank Accession CR769997 [GenBank]
Graphic View Graphic view of sequence CR769997 of line 040C05
Predicted Position of Insertion Chr4:5180444 - go to primer design
BLAST e Value 6e-104
Hit Clone Code (BAC ID) T12G13
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g26510

 
Sequence (A. th genome BLAST matches underlined)
>35-K015218-022-040-C05-8409
TTACAGTGTCTCATTATAAACGATACTGAAAGAACATACGCCAACGATACTCCCATAATG
GCCGGAACGCTTGTACACGATCAACCTCTGTACACAACGTGTTTATGCCCCACCTAAACA
ATATAGTCCTCCATAACCCCGCTTTATCACCCTATTATCCTTCAAAATACCAACCGGGCC
CATTTCAGAATGATATAATAACAT
GenBank Accession AL763761 [GenBank]
Graphic View Graphic view of gene At2g26510
Predicted Position of Insertion Chr2:11275329 - go to primer design
BLAST e Value 3e-20
Hit Clone Code (BAC ID) T9J22
Hit Gene Code At2g26510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Xanthine/uracil permease family protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on 07.07.2016 14:03