SimpleSearch - Line and FST details


Line specific information

 
Line ID 040C09
Vector Used pAC161
Line Availability only available from NASC (N403777)
Segregation Analysis 50:49:38
Confirmed for Hit At3g60400
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g14800

 
Sequence (A. th genome BLAST matches underlined)
>67-K030269-022-040-C09-8409
GAATATCCTTTTGGCTTTTGGTATTGAACCGAACCAGCTTTCGGAAAATGTTGACTAAAC
TTAATTAGAGAAGACGTGAAAGATGTCATTTCACTGAATGAAATAGTTAAAGAGAACAAA
ATTCAAAAGAAGTAAAGAGAAAGAGACTCTCATAGTCTCATGTGTCAGTTTTTGCGTGCC
TACTCTGAGAAAAAGTTATGATTATATCTTCACCAAATACTTTCTAAAACAAATTTTAAT
AAGAAACAAGTGAAGTTTGGTGTGTAACGTATGGGATCCTCCCTATAGTGAGTCNTATTA
CTCACCCCCTTT
GenBank Accession CR934385 [GenBank]
Graphic View Graphic view of gene At2g14800
Predicted Position of Insertion Chr2:6357244 - go to primer design
BLAST e Value 2e-149
Hit Clone Code (BAC ID) F26C24
Hit Gene Code At2g14800 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At3g60400

 
Sequence (A. th genome BLAST matches underlined)
>67-K028793-022-040-C09-8409
CTGATAGTTTAACCGACGGCGGTCACCGACTATCTGATCCCCGGGTTATGGGATCCTCCC
TATTGGTGAGTCTGATTCCTCCCTGAACAAAAAGACTCTTTGTATCTTGCCCCCTATGGA
ATCCATGTATTCTCCCCTCTCGCCACAGAGGAACCTTACTTTATCTTGTATGCTATGTGG
TTTCTGATTCAGGATCTTTGGTGCTGATCTTAACGACATGCATATCGTTGAGAAGGAGAT
GCCGCTGATTTAGAAAATGAAGAATCAGTCGTAGAGTTTTACGAGCATGAAGAGTCATGA
CGAAGAGTGAGAAGAGAGAAGGAAAGAGGACTGGAAGAGGGTCTACAATAGGGAGAATAG
GAACGCGCGTTATAGAAGGAGTTGATGGGTACCTAAATGAAGGAAAGTAGGGGCAGGTAC
GAGAAGCAAGATCGGAATGGGGGAAAAGATTGAGGTGAGGTGAAAACTAGAAGAGA
GenBank Accession CR934383 [GenBank]
Graphic View Graphic view of gene At3g60400
Predicted Position of Insertion Chr3:22330650 - go to primer design
BLAST e Value 9e-38
Hit Clone Code (BAC ID) T8B10
Hit Gene Code At3g60400 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mitochondrial transcription termination factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23