SimpleSearch - Line and FST details


Line specific information

 
Line ID 042C03
Vector Used pAC161
Line Availability only available from NASC (N403963)
Segregation Analysis 100:98:92
Confirmed for Hit At2g46680
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g05690

 
Sequence (A. th genome BLAST matches underlined)
>19-K015512-022-042-C03-8409
TTTACAATTGAATTATTCTTGGCGGTGCTCTGTTTTTTTTTTATAATTTTCTACTTTATT
GGGAGTGGGAAATATAAAGGTAAAACAACTAAAAATAATGGGTCGGGTTTTTAACTATAG
CGTGGGCTTGACGGGCTTTGTTTTAAAAAGCTACAAGGATCCCACTTAAATCCATTTTTA
TTTCATTTTGGATTTTGGATATTTTTCCACTAGGGGATCCTCCCTATAGGGAGANNNNNN
CCNNNNTNNTTCNNTTTTTTTTTTTTGATATTTATNCACAAGGGGCCCCCCCCTATAGAG
AGANNNCNNCCTNTCCCNACCCAATTCTCTAACAAAACACCATCTGGGGTGGTTTAAACG
TCCCCTCGCGCCCCCCGCGGGAGAGGCCCCCCCCCCACGCTCCCATCAAACAGCCCCAAC
CCCTTCTACGTCGCGTGCCGCAAACCGCCCCCCGCCGGGCCCGGATTCCCCGACACATCC
CTACCCCGTTCGCCCCACCCCGCCTTGTCCCCGCCTTCTCCCCGCCATCGCCCGGGGCGC
ACGCACAAATGTGTAGGCGGGGGGGGCGCAACCCGCCGCCGGGTCCGTTTTGCTCCCGTG
TTGTAAATGAGGGCACCCCAGCGCGCTGGCCCCGCCCTCCCCCCCCTTCCCTTAACCACC
CCCAGCCCCCTCCCCCCCCGATCCCCCCCCTCCGCGCGATCGGGGAGGGTGTCACCCCGC
ATTACCCTGCCCCCCTGTCCGCCCCCCCCCCCCCCCTATCCTCGTGCCGGCTCCCCCCCC
CCTCCCCTCGTCGTTCCCCCCCCATGCCTGTCCCATTTCAATTCTGTCAC
GenBank Accession AL763884 [GenBank]
Graphic View Graphic view of gene At3g05690
Predicted Position of Insertion Chr3:1679033 - go to primer design
BLAST e Value 6e-46
Hit Clone Code (BAC ID) F18C1
Hit Gene Code At3g05690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear factor Y, subunit A2
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At2g46680

 
Sequence (A. th genome BLAST matches underlined)
>19-K015500-022-042-C03-8409
AATTTGATCACTGTAGCTTTCCTGGAGCATGAAGCCTTTACAATTGAATATATTCTGGGC
GGGGCTTAGTGAGTGATGCCAAAATCCGCCCTATTGGTACCTGGCGACCCAAAGGTCGAT
TACTCAAAAATGAATGGAAAGGTACGATAAAGCAAACCCAGAGTGATATCTTATTATATG
CTAAGGAGCCCTGCCACAAAAGAACAACATATCACTTTTTTATATAACTGTTAACATAAT
ACTCTCAGGCGTATCACACACATATATAGATAGCCAACATCACACAAACATAGAGATTCC
AAAAAATAAAAATAAAGAAAACATAAATCCTCTGAGGAAAAATTCCGATGAGATGACAGA
AGGTGGAGAATATTCTCCGGCGATGATGTCAGCAGAGCCATTCTTGACCATGAAGAAGAT
GAAGAAGAGCAACCACAACAAGAACAATCAGAGAAGGTTTAGCGACGAGCAGATCAAGTC
ACTGGAGATGATGTTTGAGTCTGAGACAAGGCTTGAGCCAAGGAAGAAGGTTCAATTAGC
TATGGGATCCT
GenBank Accession AL763883 [GenBank]
Graphic View Graphic view of gene At2g46680
Predicted Position of Insertion Chr2:19167067 - go to primer design
BLAST e Value 1e-108
Hit Clone Code (BAC ID) T3A4
Hit Gene Code At2g46680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox 7
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40