SimpleSearch - Line and FST details


Line specific information

 
Line ID 042G09
Vector Used pAC161
Line Availability only available from NASC (N404017)
Segregation Analysis 50:46:46
Confirmed for Hit At2g18570
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g18570

 
Sequence (A. th genome BLAST matches underlined)
>71-K026603-022-042-G09-8409
TCTTTCTCACCAGAGATGCCACTTCTTCCCTTCCGATGACTCTCTCCGACGGTAACTCCG
ATGTATGGGATCCTCCCTATAGTGAGTCGAATTCCTCCGTCGGATGGGGGGGCGAGAGAA
CCAATCTATCCGGGAGATCTCCCCATTCTTCGGTGTAAGTGCACAATGCGTTCGCAAAGT
ATTTGAACGCAGGTATGGGATCCTCCCTATAGTGAGGAAGAGGCCGGACGGCCAGAGGAG
GGAGATTTTTTCGATTCCCAAATGTAAATGTCCGCAGCGTTATTATAAAGGGAAAG
GenBank Accession CR395842 [GenBank]
Graphic View Graphic view of gene At2g18570
Predicted Position of Insertion Chr2:8064754 - go to primer design
BLAST e Value 7e-29
Hit Clone Code (BAC ID) F24H14
Hit Gene Code At2g18570 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g23725

 
Sequence (A. th genome BLAST matches underlined)
>92-011515-rosso-g9-35St
CATTGNCGTAAGGGATGACGCACAATTCCACTATCCTTCGCAAGACCCTTCCTCTTATAA
GGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCC
TTCGGTTTAAACTATCAGTGTTTCCAAGAAAGAGACCTTCTCCACCTTTTTCCCCTGCTA
TGGGATCTAAACTTTGGGGGTGAGAAAAGAGGATTGAATCGGTGTATGCTTGCCAACATT
ATACTGAGCCAAACAACGTCAAAGTGGCACCCACTGAATGCTATGATTATGCACTAAGCT
GGAGGGATGCAAATGCTCCTACTCAAAGGCGTGCCTGGAGATGATCCGATTAATACTTGG
AATCACCTGAAGACTATCATGACGAGAATGGTAGCGCCTATGCATTACCAACAAGAGCTG
CACCAAAGGTTGAGGAATTTGGTTCAAGGAAATAGAACGGTTGAGGAGTACTTCAAAGAA
ATGGAAACATTGATGCTAACGGCTGATGTTCAAGAAGAGTGCGAAGCCACAATGTCTAGA
TTGATTCATGGGAGGTCTCAATAAAGACATTATAGACCGCTTGGAGGGAAACATATTGAC
AACCCTGAAGAATTGAAGAACAAGGCGCACCTGCAGAAAAACAAATAAACAAA
GenBank Accession AL763894 [GenBank]
Graphic View Graphic view of gene At3g23725
Predicted Position of Insertion Chr3:8538816 - go to primer design
BLAST e Value 2e-110
Hit Clone Code (BAC ID) MYM9
Hit Gene Code At3g23725 [TAIR] [MIPS] [SIGnAL]
Gene Annotation transposable element gene
Insertion Classification TS2TE
Confirmation Status unknown


Last Updated on 14.10.2014 10:23