SimpleSearch - Line and FST details


Line specific information

 
Line ID 043D04
Vector Used pAC161
Line Availability only available from NASC (N404072)
Segregation Analysis 50:10:7
Confirmed for Hit At4g29340
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g29340

 
Sequence (A. th genome BLAST matches underlined)
>28-K026820-022-043-D04-8409
TTTTTGAAGAAAAAGTATGATGTACGCCTGATAATTCGTCTATGTGATCCAACGGTTTTA
AAATGATCCTTGTTCCTTCCTCTCCTATTTATCTGAAGGACGAAGTCCCCACGCTGCACA
TAACCGGGGCACTTAACGTATAGATCATAAACAAAGAAGAAGAAAAAAAATAAGAAAAGA
AGAAGAAGATGTCGTGGCAAACTTACGTTGATGAGCATTTGATGTGTGATGTTGGCGATG
GTCAAGGACACCACCTTACTGCTGCCGCTATCGTTGGTCATGACGGTAGCGTTTGGGCTC
AAAGCGCCAACTTCCCTCAGGTATTTGATTTCATTGCGTCTGATCTCAATGTGATTTAGA
TCCTGATAGTGTTGCTATCCGATATGATATGTGTTTTTACAATGTGATTTAAATCATGCA
TCATGTTTTGATTACATTCAAACAAGGTTTGTCATGGAATATATAT
GenBank Accession CR395895 [GenBank]
Graphic View Graphic view of gene At4g29340
Predicted Position of Insertion Chr4:14447494 - go to primer design
BLAST e Value 1e-138
Hit Clone Code (BAC ID) F17A13
Hit Gene Code At4g29340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation profilin 4
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR395894 [GenBank]


Last Updated on 31.08.2016 09:40